ID: 901364565

View in Genome Browser
Species Human (GRCh38)
Location 1:8735195-8735217
Sequence TTGTTACAATCTAAAATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901364564_901364565 -2 Left 901364564 1:8735174-8735196 CCTTAGCTGTTTGGCTGCAATTT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 901364565 1:8735195-8735217 TTGTTACAATCTAAAATCTAAGG 0: 1
1: 0
2: 0
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901364565 Original CRISPR TTGTTACAATCTAAAATCTA AGG Intronic
901364565 1:8735195-8735217 TTGTTACAATCTAAAATCTAAGG + Intronic
906438147 1:45814955-45814977 TAATTACATTCTAAAACCTAGGG - Intronic
908133960 1:61109083-61109105 TTTTTACAATTTAAAATGTCTGG + Intronic
908345752 1:63230699-63230721 TTTTTAGATTCTAAAATGTAAGG + Intergenic
908702329 1:66915542-66915564 TTGTCATAATTTAGAATCTAAGG + Intronic
909771992 1:79435237-79435259 TTACTACAATTTAAAATATATGG + Intergenic
910361914 1:86421365-86421387 ATTATAAAATCTAAAATCTATGG + Intergenic
911048233 1:93646969-93646991 TTGTCATAATTTAGAATCTAAGG + Intronic
911418083 1:97601305-97601327 TTGGTAAAATATAAAAACTATGG + Intronic
911781056 1:101879065-101879087 TTGTTAGAATCTCAAAGCTGAGG - Intronic
912103631 1:106242976-106242998 TTGTTCCATTTTTAAATCTAGGG + Intergenic
915652588 1:157327893-157327915 TTGTCATAATTTATAATCTAAGG - Intergenic
915652622 1:157328499-157328521 TTGTCATAATTTAGAATCTAAGG + Intergenic
916464837 1:165063373-165063395 TTGTTAAAATTTAAATTCTTGGG - Intergenic
917471024 1:175325997-175326019 TTATTACACTCTAAGTTCTAGGG - Intronic
917549840 1:176014588-176014610 TTTTTAAAAATTAAAATCTAAGG + Intronic
919007930 1:191923743-191923765 TTGTTTGAATCTTAAATTTAGGG - Intergenic
919148501 1:193664828-193664850 TTCATACAACCTAAAATCCATGG - Intergenic
919367194 1:196676838-196676860 TTGTTAAAAACTAAAATCTTTGG + Intronic
921285911 1:213609248-213609270 TTGTAACAATCTAGAATTTCAGG + Intergenic
921405989 1:214780072-214780094 TTGTTAAGACCTAAAATGTATGG + Intergenic
921528307 1:216245981-216246003 TAGTTAAAATCTTAAATGTAAGG + Intronic
922284723 1:224160068-224160090 TTGTTCAAATCTTAAATCTTAGG + Exonic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
924529506 1:244881477-244881499 TAGTTACATTGTAAAATCTTTGG - Intergenic
924750721 1:246886523-246886545 TTGTTATAGTGTAACATCTAGGG + Intronic
1063937689 10:11095927-11095949 ATGTTACACTGTAAATTCTAAGG - Intronic
1065968289 10:30785875-30785897 TTTGTAAAATCTAAAATGTAAGG - Intergenic
1065990110 10:31000719-31000741 ATGTTACAATTTAAAATCTGGGG + Intronic
1071240457 10:83699312-83699334 ATGTTAAAATCAAAAAGCTATGG + Intergenic
1074622611 10:115141420-115141442 ATGTTAAAATCTAAAACCAAAGG - Intronic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1078824278 11:14913171-14913193 TTGTTACACTCTATAGTGTAGGG + Intronic
1079646797 11:22873412-22873434 TTCTTAAAATCTCAAATCAAGGG + Intergenic
1081013993 11:37853209-37853231 TTGATTCAATTTAAAATATAGGG - Intergenic
1086136824 11:83450177-83450199 TTGTTACAATGCAGAATCTTAGG - Intergenic
1088320570 11:108550884-108550906 ATCTTCCAGTCTAAAATCTATGG + Intronic
1088428798 11:109734184-109734206 TTGTTACCTTCTAAAATATGTGG - Intergenic
1092898966 12:13040668-13040690 TTTTTACACTCTAAAATCATTGG + Intergenic
1098729645 12:74016915-74016937 TTGTTTCAAAATAAAATCTGTGG + Intergenic
1100088954 12:90946817-90946839 TTTTTACAATTTAAAATACATGG - Intronic
1100722887 12:97377428-97377450 TTTTTAAAATCTAAAATGTAGGG + Intergenic
1102354330 12:112220226-112220248 TTTTAAAAATCTAATATCTATGG + Intronic
1105668515 13:22587204-22587226 TTGATGCAATCTACAAACTATGG - Intergenic
1106727118 13:32497373-32497395 TTTTTAAAAACTAAAATCTTGGG - Intronic
1107243225 13:38262638-38262660 TAGTTACAATTCAAAATTTAAGG - Intergenic
1107501459 13:40981771-40981793 TTGTTACCATATCAAAGCTAAGG + Intronic
1108318642 13:49264130-49264152 CTGTTACAAGCTAAAATATTTGG - Intronic
1109992526 13:70077579-70077601 TTGTTATTATCCAAAATCTATGG - Intronic
1111020521 13:82442677-82442699 TTGTAGCAATGTAGAATCTATGG - Intergenic
1111217355 13:85161925-85161947 CTGTATCAATCTAAAATCTTTGG - Intergenic
1111261042 13:85740698-85740720 TTGTTTTAAACTAAAATCTAAGG + Intergenic
1112324321 13:98433271-98433293 TTGTTAATATCTAGAATATATGG + Intronic
1112951683 13:105005328-105005350 TTTTTACAATCATAAAGCTAGGG + Intergenic
1113351547 13:109534172-109534194 TTGTTATGATTAAAAATCTATGG - Intergenic
1114942118 14:27625145-27625167 TAGTAACAATCTATAAGCTAGGG - Intergenic
1116479557 14:45382258-45382280 TTGACACACTTTAAAATCTAAGG - Intergenic
1117458808 14:55924672-55924694 TTGCTAGAATCTAACATCTTGGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118816083 14:69314978-69315000 CTGTTTAAATCTAAAATTTAGGG + Intronic
1119066780 14:71536033-71536055 ATGCTACATTGTAAAATCTAAGG + Intronic
1120324080 14:83003327-83003349 TTTTAAAAATCTTAAATCTATGG - Intergenic
1120402241 14:84046789-84046811 TAGAGACAATCTCAAATCTAAGG + Intergenic
1124583453 15:30983552-30983574 GTGTTCCAACCTAAAATGTATGG - Intronic
1126217969 15:46178516-46178538 TGGTTATAAGGTAAAATCTAGGG - Intergenic
1126274762 15:46864134-46864156 TATTTAAAATCTAAAATATATGG + Intergenic
1126375754 15:47995333-47995355 TTTTTCCAATTTAAAATTTAGGG - Intergenic
1126708059 15:51425613-51425635 TTGTTATAGTTTAGAATCTAAGG - Intergenic
1127000581 15:54499646-54499668 TAGTTATGATCTATAATCTATGG - Intronic
1127575513 15:60287832-60287854 TTGTTAGAATCTAAATTCCCTGG - Intergenic
1127592777 15:60443564-60443586 TTGTTAAAATGTAGAATCTGGGG + Intronic
1137238527 16:46634997-46635019 TGGTTACCATCTACAATCAATGG - Intergenic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1141069141 16:80937495-80937517 TTCTTCAAATCTAAACTCTAAGG + Intergenic
1142329527 16:89442534-89442556 TTGTTTTGACCTAAAATCTAGGG - Intronic
1143930940 17:10423485-10423507 TTATTACAATCTTAAACCTACGG - Intergenic
1146132812 17:30292806-30292828 TTTTTACAATCTCAAAACTTTGG - Intergenic
1149239681 17:54634665-54634687 ATTTTAAAATCTATAATCTATGG - Intergenic
1154264068 18:12864368-12864390 TGTTTACAATTTAAAATCTTTGG - Intronic
1155428448 18:25730084-25730106 ATGTTACATTTTAAAATCTGTGG - Intergenic
1159135686 18:64334533-64334555 TTGTTAGAATCTATGGTCTATGG - Intergenic
1159183068 18:64934620-64934642 TTGTTACAGGTTAAAATCTGAGG + Intergenic
1159294866 18:66471981-66472003 TTGTTGTAATCTAAAATGTTTGG + Intergenic
1159827834 18:73236618-73236640 TTGATACAATAAACAATCTAGGG - Intronic
1160195121 18:76747523-76747545 TTGATAAAATGTAAAATCTTTGG + Intergenic
1161677107 19:5657856-5657878 TTGTTACCTTCTACAATCTTTGG - Intronic
1164650699 19:29889432-29889454 TGGTTAAAATCTTAAATGTATGG + Intergenic
1166028901 19:40110572-40110594 TTGATAAAATGTAAAATCTTTGG + Intergenic
928510876 2:32001845-32001867 TTGTAACAATTAAAAATATATGG + Intronic
930146454 2:48011366-48011388 TTGATATAATCTAAAATGTGGGG - Intergenic
930542354 2:52722488-52722510 TTGTTGCAGTCAAAACTCTAAGG + Intergenic
933164735 2:79063753-79063775 TTGTTAGAATGCAAAATCTTAGG + Intergenic
933430678 2:82173688-82173710 TTGTTATAATTTGAAATCTATGG - Intergenic
933742230 2:85543337-85543359 TTGTTGCAATGTAAAAACCATGG + Intronic
934092251 2:88561998-88562020 TTGTTATAAGTAAAAATCTAGGG - Intronic
936392728 2:112090047-112090069 TTGATACATTTTAAAATCCAGGG - Intronic
936971004 2:118176018-118176040 TTTTTATAATCTTAAATTTAAGG - Intergenic
938590609 2:132732414-132732436 TTATTACACTTTAAATTCTAGGG - Intronic
939637141 2:144595889-144595911 TTGCTACAACCTAAACTCCAAGG - Intergenic
939683287 2:145166103-145166125 TTCTTACATACTAAAATTTATGG + Intergenic
940279071 2:151971090-151971112 AGGTTACAAACTAAAATCTAGGG + Intronic
941248025 2:163125089-163125111 TTGTTACACTTTAAGTTCTAGGG - Intergenic
942868838 2:180710328-180710350 TGGTTACAAAGTAAAACCTAAGG + Intergenic
943270710 2:185799149-185799171 TTGTGACAAACTATAATCTAGGG + Intronic
943554819 2:189389577-189389599 TTATTCCAATCTAAAATTTATGG - Intergenic
943611273 2:190037890-190037912 TTTTTACAATGAAAAATTTAGGG + Intronic
944171928 2:196788762-196788784 TCGGTACAATCTAAAATACAGGG + Intronic
944304379 2:198162937-198162959 TTGTTACAATTTACAAAATAAGG + Intronic
944322447 2:198363925-198363947 CTGTTATAATTTAAAACCTAGGG + Intronic
944323937 2:198381291-198381313 TTGTTACAATTTAATATACATGG + Intronic
944532256 2:200679044-200679066 TTGTTAAAATTAAAAATCTCAGG - Intergenic
945515126 2:210754036-210754058 TTCTTAGAGTCTAAAATATAAGG + Intergenic
945640087 2:212414502-212414524 CTGTTTCATTCTAAAATCTCAGG + Intronic
945707380 2:213252525-213252547 TTGTTCCAATCAAAAAAATAGGG + Intergenic
945968514 2:216213517-216213539 TTGATAAAATGTAAAATCTTTGG + Intergenic
947607160 2:231494607-231494629 TTGTTACAAAACTAAATCTAAGG - Intergenic
1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG + Intronic
1170170141 20:13401538-13401560 TTGTTACATCATAAAATCAATGG + Intronic
1170558845 20:17538399-17538421 TTGTTACAATTTCAAACTTATGG - Intronic
1172892463 20:38276673-38276695 TTGTTAAAAACTAAAATGGAAGG + Intronic
1176961457 21:15163718-15163740 ATGTTACAATGTAAAATATAGGG - Intergenic
1177300820 21:19244084-19244106 TTGTAACATTTTAAAATATAGGG - Intergenic
1177390774 21:20468280-20468302 TGAACACAATCTAAAATCTAGGG + Intergenic
1177812987 21:25944775-25944797 TTGTTCCAGTCTAAAATCATTGG + Intronic
1179601442 21:42480294-42480316 TTGTTAGATTCTAAAACCAAAGG - Intronic
1181869771 22:25888560-25888582 TTGTTAAAATGCAAATTCTAGGG - Intronic
1183227335 22:36559419-36559441 TTGTGACAAACTAAAATGTTAGG - Intergenic
1184102720 22:42349195-42349217 TTCTTACAATGTACAATCAAAGG + Intergenic
1184897727 22:47421592-47421614 TTGTTTTATTCTAAAATATATGG + Intergenic
949999307 3:9644345-9644367 TTATTACACTCTAAGATCTAGGG - Intergenic
951483355 3:23185147-23185169 TTTTTACAATCTACATTGTAAGG + Intergenic
951744699 3:25964641-25964663 TTGCTACAATATAAAGTCTGTGG + Intergenic
952324393 3:32307799-32307821 TTGTTAGAATGCAAATTCTATGG - Intronic
952675604 3:36026708-36026730 ATGGTACAATTTAAAATTTAAGG - Intergenic
957576937 3:82020049-82020071 GTGTTACAATGAAAACTCTAAGG - Intergenic
959749521 3:109816914-109816936 TTGTGACAATTTAAAAATTAGGG + Intergenic
959997753 3:112697321-112697343 TTGTTACAATGTAAAAACCATGG - Intergenic
963739358 3:149060430-149060452 TAGTTGCAAATTAAAATCTAAGG - Intronic
965055522 3:163708831-163708853 TTGTTAGAAGATAAATTCTATGG + Intergenic
965075656 3:163971970-163971992 TTGTAACAATCTATCACCTATGG - Intergenic
967159770 3:186725454-186725476 TTGTTAAAATCAAACATCAAAGG - Intronic
967667148 3:192186310-192186332 TTGATACATTCTAAAATGTCAGG + Intronic
970225530 4:13852707-13852729 TTGTTAGAAACTAAATTCTCAGG + Intergenic
970677336 4:18465846-18465868 TTCTTACAACCTCAAAACTACGG - Intergenic
972575216 4:40345198-40345220 GTGTTATGATCAAAAATCTAGGG + Intronic
972706011 4:41543633-41543655 TTGTTACTATCTTAATTCTTTGG + Intronic
974401319 4:61411464-61411486 GTGTTACAAAATAATATCTATGG - Intronic
975267288 4:72385254-72385276 TTGGTACAATATTAACTCTAAGG + Intronic
976971963 4:91114892-91114914 TTCTTACATTTTAAAATCTGTGG - Intronic
977815929 4:101414122-101414144 TTGTTACAATGGTAAAACTAAGG - Intronic
979006626 4:115306706-115306728 TTCTTACAGTCTAAAACCAATGG + Intergenic
979047184 4:115882884-115882906 TTGCATCAATATAAAATCTATGG + Intergenic
980314580 4:131180984-131181006 TTGTTCCCATCTCAACTCTATGG + Intergenic
980525097 4:133979729-133979751 ATGTGACTGTCTAAAATCTATGG + Intergenic
980805432 4:137807128-137807150 TTGTTAAAATCTGGAATCTCAGG + Intergenic
980932734 4:139197075-139197097 TTCATACTATCTAAAATTTAAGG + Intergenic
981568703 4:146129884-146129906 CTGTTACATTCTAAAATCTCAGG + Intergenic
982552305 4:156818255-156818277 TTTTTACAATTGAAAATTTATGG + Intronic
982579275 4:157157352-157157374 TTATTACACTTTAAATTCTAGGG + Intronic
983332638 4:166351127-166351149 TTGTTACACTCTAATATTTCAGG + Intergenic
983520776 4:168706568-168706590 TTGTTAAAAGCTAAAATGCAAGG - Intronic
983982820 4:174019695-174019717 GTGTGACAATGTAAACTCTAGGG + Intergenic
984110885 4:175612372-175612394 TTGTTATAATCTAGGATTTATGG + Intergenic
987812093 5:22850787-22850809 ATGTAAAAATATAAAATCTAAGG - Intronic
987996614 5:25290264-25290286 TTATTATACTCTAAATTCTAGGG - Intergenic
991777211 5:70096794-70096816 TGGTTTCAATCTAGAATCCATGG + Intergenic
991856497 5:70972237-70972259 TGGTTTCAATCTAGAATCCATGG + Intronic
993928998 5:93913751-93913773 ATGTAACAAACTAAAATTTATGG + Intronic
994615104 5:102093985-102094007 TTGTTCTAATCTAAACACTATGG - Intergenic
995270297 5:110212879-110212901 TTGTTACACTTTAAGTTCTAGGG + Intergenic
998580834 5:143374104-143374126 TTTTAACAATTTAAAATCTGGGG - Intronic
1000810837 5:165858739-165858761 TTATCACAATATGAAATCTATGG - Intergenic
1000829850 5:166089144-166089166 TTGGTACAATCTAAATACAAAGG - Intergenic
1001750628 5:174128219-174128241 TTATTACACTTTAAATTCTAGGG + Intronic
1004656717 6:17669570-17669592 TTGTTGCAACATAAAATCTAAGG + Intronic
1008001042 6:46360100-46360122 TTGTTAAAATGAAAATTCTAGGG + Intronic
1008036275 6:46748891-46748913 TTGTTACAATGCAGAATCTCAGG + Intronic
1008217005 6:48804604-48804626 TTTTTTAAATCTAAAATCGAAGG - Intergenic
1008563167 6:52741764-52741786 TTTTTAAACTATAAAATCTAAGG - Intergenic
1008650709 6:53558867-53558889 TTGTCATAATTTAGAATCTAAGG + Intronic
1009507825 6:64507197-64507219 TTGTTATACTTTAAATTCTAGGG + Intronic
1010638549 6:78291266-78291288 TTGAAACAATTTAAAATTTAAGG - Intergenic
1011973130 6:93254419-93254441 TTTTTATAATATAAATTCTATGG - Intronic
1012111425 6:95240320-95240342 TGGTTACAATATAAAATATTTGG + Intergenic
1012487750 6:99741061-99741083 CTGTTACAAATAAAAATCTAGGG + Intergenic
1014565037 6:122938522-122938544 TTGGTACACTGTAAAAGCTATGG + Intergenic
1014780144 6:125556115-125556137 TTAGTACATTCTAAAATTTATGG + Intergenic
1015656987 6:135530379-135530401 TTCTACCAATCTAAAATCCAAGG + Intergenic
1016451867 6:144191203-144191225 TTGTTACCACCTATAATCTGTGG - Intergenic
1020523879 7:9232180-9232202 TAGCTACAATTTAAAATCTATGG + Intergenic
1020868430 7:13595886-13595908 TTGTTATAATATAACATCAAGGG - Intergenic
1021168270 7:17367433-17367455 TTGTTACAATCTAAACTGTTTGG - Intergenic
1023069469 7:36414650-36414672 TGGTTCCACTATAAAATCTACGG - Intronic
1023228341 7:37996482-37996504 TTGTTATACTTTAAATTCTAGGG + Intronic
1024420317 7:49158180-49158202 TAGTGACAATATAAACTCTACGG + Intergenic
1024787798 7:52928207-52928229 AGGCTACAATCCAAAATCTAAGG - Intergenic
1028202404 7:87976882-87976904 TTGATACAGTAGAAAATCTAGGG + Intronic
1028208714 7:88046874-88046896 TTGATACAATATAAAATCATGGG + Intronic
1028580386 7:92403728-92403750 CTGTTACAATGTAAAATAAATGG + Intergenic
1031291868 7:119948574-119948596 TGGTTACAATCTACAATCCTTGG + Intergenic
1032821641 7:135529465-135529487 TTGTTACAATCTCATATGTCAGG - Intergenic
1037216720 8:16463622-16463644 TTGTAACAAACTACAAACTATGG - Intronic
1038830137 8:31047988-31048010 TTGTTACTAACTAAAATTAATGG + Intronic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1041026342 8:53690632-53690654 GTGTTAGAACCTAAACTCTAAGG + Intergenic
1041712623 8:60908041-60908063 TTGTTACATTGTAATATATAAGG - Intergenic
1042669371 8:71244941-71244963 TTTTTAAAATTTAAAATCTAGGG + Intronic
1043509719 8:80937687-80937709 TAGTTACAATCTGAAAGCTTTGG - Intergenic
1045458386 8:102404986-102405008 AGGTTACAATCCAAATTCTAAGG + Intronic
1045730807 8:105238733-105238755 TTGTTAAAATGCAAAATCTTGGG - Intronic
1046108617 8:109694386-109694408 TAATTCAAATCTAAAATCTAGGG - Intergenic
1046944310 8:119960292-119960314 TTGTTATCATCAAAAATCTTGGG - Intronic
1047094942 8:121614852-121614874 TTGGTACAATCAAGAATTTATGG - Exonic
1047673505 8:127174130-127174152 TTGTTAGAATTTAGAATCTTAGG - Intergenic
1048615583 8:136071591-136071613 AGGTCAAAATCTAAAATCTAAGG + Intergenic
1050818598 9:9848186-9848208 AAATTACAATGTAAAATCTATGG - Intronic
1052684785 9:31741565-31741587 ATGTTTCAATTGAAAATCTAAGG - Intergenic
1052961052 9:34297306-34297328 TTCTTACAAGGTAAAAACTAAGG + Intronic
1053380242 9:37643577-37643599 TTTTTAAAATCAAAAATGTAAGG - Intronic
1055028865 9:71751652-71751674 TTTTTAAAATGTAAAATCCAGGG - Intronic
1055068370 9:72142254-72142276 TTGATACAATGTAAAACTTAAGG + Intronic
1186278864 X:7970985-7971007 TTGTTTAAACCTAAAATATATGG + Intergenic
1188169417 X:26905127-26905149 TTGTTACAATGCATACTCTAAGG - Intergenic
1188334162 X:28908037-28908059 TTATTACCATCTAATATCTGTGG + Intronic
1188510855 X:30934952-30934974 TTGTTAGAAGCCAAAATCGAAGG + Intronic
1190408179 X:50108546-50108568 TTGTTAAAATCTCAGATCAAAGG - Intergenic
1193870341 X:86789400-86789422 TTGTTGCAACCTAAAAGTTAGGG - Intronic
1194095801 X:89637149-89637171 TTGTTATACTTTAAATTCTAGGG + Intergenic
1196205240 X:112931885-112931907 AAGTCACAATGTAAAATCTAAGG - Intergenic
1196610782 X:117712273-117712295 TTGTTTCAATCTAAAGTTTCAGG - Intergenic
1198033238 X:132775746-132775768 TTATTAAAATCTAAAAATTAAGG - Intronic
1199692025 X:150315796-150315818 CTGTTACAATCTCACATCTGAGG + Intergenic
1200448802 Y:3298520-3298542 TTGTTATACTTTAAATTCTAGGG + Intergenic
1202329274 Y:23729605-23729627 TTGTTACATTATAAAAACCATGG - Intergenic
1202541497 Y:25940449-25940471 TTGTTACATTATAAAAACCATGG + Intergenic