ID: 901365241

View in Genome Browser
Species Human (GRCh38)
Location 1:8742072-8742094
Sequence ATATACATACTACACTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901365241 Original CRISPR ATATACATACTACACTGGGA TGG (reversed) Intronic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
907905496 1:58781439-58781461 ATTTACAAACAACACTGGGCAGG + Exonic
909069394 1:70976381-70976403 ATAAACATACCACTCTGGTAGGG + Intronic
910844353 1:91591301-91591323 AGAGACATAGTACAGTGGGATGG + Intergenic
920579597 1:207093677-207093699 ATATATTTATTACATTGGGATGG + Intronic
922011496 1:221593171-221593193 GTATAAATACTGCATTGGGAAGG + Intergenic
1063935431 10:11072695-11072717 ATCTACAGACTCCACAGGGATGG - Intronic
1064281073 10:13952022-13952044 ATATTCATCTTACATTGGGAAGG + Intronic
1064595968 10:16945610-16945632 ATATAAAAACTAGCCTGGGATGG + Intronic
1067213693 10:44282677-44282699 ATACACATACTACACCTGCAAGG - Intergenic
1068442469 10:57076143-57076165 ATTTATATAATACAGTGGGAAGG + Intergenic
1068479684 10:57575052-57575074 ATTTACATAGTGCACAGGGAAGG + Intergenic
1068957346 10:62830131-62830153 CTATACCTAATACAATGGGATGG + Intronic
1069506524 10:69003211-69003233 ATGTACATACTTCACTGTTATGG - Intronic
1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG + Intergenic
1069890082 10:71647066-71647088 AGATACAAATGACACTGGGAGGG - Intronic
1071921443 10:90355418-90355440 ATTTACATAGTACATGGGGAAGG + Intergenic
1071982348 10:91016033-91016055 ATATATATAATACACTGTGTAGG + Intergenic
1079371028 11:19852481-19852503 ATATACATACTAAGCTGTCATGG + Intronic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1081302685 11:41472190-41472212 ATATTCTTGATACACTGGGATGG - Intergenic
1086225267 11:84500786-84500808 ATATTTATACTACACTGTGTTGG - Intronic
1088611819 11:111584801-111584823 ATATACTAACTTCACTGGGTAGG - Intergenic
1092773159 12:11916960-11916982 ATATACATCCTACCCAGTGATGG - Intergenic
1092923202 12:13250728-13250750 AAATACATTATACACTGTGATGG - Intergenic
1093200604 12:16181932-16181954 AAATACATACTTTACTGGGCTGG + Intergenic
1097394674 12:59059351-59059373 AGAGCCAAACTACACTGGGAAGG - Intergenic
1098036397 12:66307556-66307578 ATCTCCATTCTACACTGGTAAGG - Intronic
1102944684 12:116975695-116975717 TGATACATAATGCACTGGGAAGG + Intronic
1105556979 13:21456520-21456542 CTATACATATTTCAGTGGGAGGG + Intronic
1106666291 13:31854291-31854313 AGAGACATGCTTCACTGGGATGG - Intergenic
1107191940 13:37599080-37599102 TTATACATTCTACTCTGGAAAGG - Intergenic
1107509102 13:41063655-41063677 AAAGACAGACTACACTGGAAGGG - Intronic
1108563900 13:51675282-51675304 ATATACATACTCCACAGGAAGGG - Intronic
1109612638 13:64786833-64786855 ATTTACATAGTACACGGGGAAGG + Intergenic
1109720390 13:66268588-66268610 ATACATATACAACACTAGGATGG - Intergenic
1112631955 13:101171591-101171613 ATATATATAACACACAGGGAAGG + Intronic
1113055375 13:106261350-106261372 ATATACATAATACCCTGTGGTGG - Intergenic
1118464086 14:66015009-66015031 ACATCCATATTACACTTGGAAGG - Intergenic
1120751254 14:88200585-88200607 AAATAAACCCTACACTGGGAAGG + Intronic
1123673081 15:22680114-22680136 ATATACATATAACACTGCCAAGG - Intergenic
1124325136 15:28753407-28753429 ATATACATATAACACTGCCAAGG - Intergenic
1126074826 15:44899009-44899031 ATAAACTGACTAGACTGGGATGG - Intergenic
1126083539 15:44988806-44988828 ATAAACTGACTAGACTGGGATGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1131204395 15:90429141-90429163 ATAAAAATACCACGCTGGGACGG - Intronic
1131691163 15:94829464-94829486 TAATACATATTACTCTGGGAAGG - Intergenic
1132050087 15:98600485-98600507 ATACACACACTGCACTGGCAAGG + Intergenic
1133713494 16:8425253-8425275 GTATACGTGCTACTCTGGGAAGG - Intergenic
1137509201 16:49083252-49083274 ATATACTCACTTCTCTGGGATGG + Intergenic
1150052281 17:61976637-61976659 ATATACAAACTATACTGGCTGGG + Intronic
1150666016 17:67139268-67139290 ATACACAGACTACCCAGGGAAGG + Intronic
1154336957 18:13473706-13473728 ATATACATATTATACAGGGGCGG + Intronic
1155233381 18:23795444-23795466 ATATACCTGCTTCATTGGGAAGG + Intronic
1156150890 18:34241783-34241805 ATTTACACACTGCACAGGGAAGG + Intergenic
1157419539 18:47533817-47533839 ATATACCTACCTCACTGGGTAGG - Intergenic
1159139972 18:64381785-64381807 ATTTACATAGTGCACAGGGAAGG - Intergenic
1161900218 19:7112960-7112982 ATATACATGGTACACAGAGAGGG - Intronic
1164729057 19:30488148-30488170 ATAGTCATCCCACACTGGGAGGG - Intronic
1165568882 19:36758169-36758191 GTATACATACTACACCTGTAAGG - Intronic
924982927 2:239675-239697 AGATACATTCTACAGTGGGATGG - Intronic
925086281 2:1110082-1110104 ATATATATACTACATTTGGTGGG + Intronic
927995127 2:27479635-27479657 ACACACATAGTACACTGGCATGG + Intronic
930401257 2:50892437-50892459 AAAAACATATTATACTGGGAGGG - Intronic
932547643 2:72731438-72731460 AGATACATACAATACTAGGAAGG + Intronic
933106455 2:78333301-78333323 GTATCCATACTACACTTGAAGGG + Intergenic
934591558 2:95555664-95555686 ATGCACATCCCACACTGGGAAGG + Intergenic
936507643 2:113120418-113120440 ATAAAAACACTACACTGGCAGGG + Intronic
936783382 2:116062177-116062199 ACATACATTCTAAATTGGGATGG + Intergenic
937464295 2:122116785-122116807 AGATAGATAACACACTGGGAAGG - Intergenic
939168003 2:138659897-138659919 TTATATATACTAAACTGGAATGG + Intergenic
939741166 2:145908194-145908216 ATATACCCACTACCATGGGAAGG - Intergenic
940388761 2:153106269-153106291 ATATGCCAACTACACAGGGAGGG - Intergenic
942368133 2:175251174-175251196 ATATATATATTACATTGAGATGG + Intergenic
943567443 2:189532723-189532745 ATGTATATATTACACTAGGAAGG + Intergenic
944798910 2:203216168-203216190 ATATTTATTATACACTGGGAAGG + Intronic
947050708 2:226039543-226039565 ATAAACATACTTCCCTGTGATGG - Intergenic
947653266 2:231805400-231805422 ATATATATAATAAACAGGGAGGG - Intronic
1173531199 20:43770948-43770970 CTATACAAGCTCCACTGGGAGGG + Intergenic
951301334 3:21000905-21000927 ATATTAATAGTAAACTGGGAAGG + Intergenic
952523868 3:34189298-34189320 AGATACATGCTGCTCTGGGAAGG + Intergenic
958150558 3:89688360-89688382 ATATAGATGCCACACTGCGAAGG - Intergenic
964676737 3:159291112-159291134 ATATACAAAATACACAAGGAAGG + Intronic
969710974 4:8843271-8843293 ATATATACACTACTCTGGCATGG + Intergenic
973127621 4:46607277-46607299 AAATACCTACTAAACTGGAAAGG + Intergenic
974924294 4:68278236-68278258 ATATACATTTTACATTTGGAAGG - Intergenic
977868332 4:102058233-102058255 ATATACTCACTACAATGGGTTGG + Intronic
978945246 4:114487953-114487975 ATAAACATACTAGAGTGGCATGG + Intergenic
979088387 4:116445069-116445091 AAATATATACTACAGTGGCATGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
981779090 4:148405435-148405457 ATATCCACACTACACTTGTAGGG + Intronic
981916614 4:150040792-150040814 ATATGCATGCTACATTGGAAAGG - Intergenic
982671689 4:158327729-158327751 ATTTACATATTGCACAGGGAAGG - Intronic
988633094 5:32952083-32952105 ATTTACATGCTGCACGGGGAAGG + Intergenic
989426100 5:41297776-41297798 AGATTCATACTTCACTGGGGAGG - Intergenic
991450620 5:66747207-66747229 ATATACATATTTCTCTTGGAAGG + Intronic
995239208 5:109866595-109866617 ACATACAGACTACGCTTGGAAGG - Intronic
996524972 5:124469258-124469280 ATATACAGACCACAGAGGGAGGG + Intergenic
996796288 5:127352098-127352120 ATATATATATTTCTCTGGGAAGG + Intronic
1001307107 5:170583359-170583381 ATATACACAAGGCACTGGGAAGG - Intronic
1001932257 5:175681558-175681580 ATATACAGCCACCACTGGGAGGG + Intronic
1007286248 6:40749508-40749530 ATATACATTCTTCACAGGGGTGG + Intergenic
1007364240 6:41379529-41379551 ATAAACATAGTACACTTAGAGGG + Intergenic
1008026392 6:46640950-46640972 GTATACATACTATACTGGTATGG - Intronic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1020365474 7:7376152-7376174 ATAAACACACTGCACAGGGAAGG - Intronic
1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG + Intronic
1024260342 7:47569554-47569576 ACATACATATTACACAGGGACGG + Intronic
1028498800 7:91494261-91494283 ATATACATTCTCTACTGTGAGGG + Intergenic
1028983500 7:96992647-96992669 ATAAGCGTACTACACAGGGAAGG - Intergenic
1029909488 7:104130313-104130335 ATATAGAGACTACAGTGGAAAGG - Intronic
1030256490 7:107514673-107514695 ATATACATTCTACAAAGGGTAGG + Intronic
1034247746 7:149661740-149661762 AAATACAAAATACACTGGGAAGG - Intergenic
1040654000 8:49483224-49483246 ATATACATGCAACACTAGGATGG - Intergenic
1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG + Intergenic
1044641520 8:94387395-94387417 ATATTAATACTACACTTGCAGGG - Intronic
1052808354 9:33033728-33033750 ATATAAATACTACAATAGAAGGG + Intronic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1189975565 X:46458691-46458713 ATATAAATATTTCACTAGGATGG - Intronic
1191179616 X:57546150-57546172 ATTTACATAGTACTTTGGGAAGG - Intergenic
1193016688 X:76741520-76741542 GAATACAAACTCCACTGGGATGG + Intergenic
1193662791 X:84277241-84277263 ATATACACACAAAACTGGAATGG - Intergenic
1198204752 X:134455137-134455159 ATTTACATACTGCTCTGTGAAGG + Intergenic