ID: 901370608

View in Genome Browser
Species Human (GRCh38)
Location 1:8794456-8794478
Sequence CTGTGATTGTTGAGGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901370608 Original CRISPR CTGTGATTGTTGAGGTGGCA GGG Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
902040730 1:13490526-13490548 CAGTGATGGTTGAGATGACAGGG - Intronic
902515620 1:16987983-16988005 GTGTGGTTGGAGAGGTGGCAAGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904329528 1:29749195-29749217 CTGTGTTTGTGGTGGGGGCAGGG - Intergenic
904794559 1:33049554-33049576 CTTTGCTTGTTCAGGTGGCTTGG - Intronic
904838246 1:33353642-33353664 CTGTGTTTGCTGAGGGGGTAGGG - Intronic
905015816 1:34777704-34777726 GTGTGATGGTGGAGGTGGCTGGG - Intronic
906166425 1:43689777-43689799 CTGTGGTGGTTAAAGTGGCATGG + Intronic
906468495 1:46106448-46106470 TTGAGATTTTTGAGGGGGCAGGG - Intronic
909512903 1:76475085-76475107 CTGGGAATGCTGAGGTGGCGAGG + Intronic
912616096 1:111101804-111101826 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
914348827 1:146822325-146822347 CTGTGCTCTTTGAGGTTGCATGG + Intergenic
914666909 1:149840165-149840187 CTGTGCTAGTGGAGGTGGCGCGG + Exonic
914668858 1:149853625-149853647 CTGTGCTAGTGGAGGTGGCGCGG - Exonic
916819809 1:168387201-168387223 CTGTGTTTGCTGAGGTGGGTGGG + Intergenic
917480247 1:175405661-175405683 GTGTGCTTTTTGAGGGGGCAGGG + Intronic
919339688 1:196288515-196288537 TTGTGAATGAGGAGGTGGCATGG + Intronic
919610923 1:199744800-199744822 CTGTGGTTGATGAAGAGGCAGGG + Intergenic
919944389 1:202308993-202309015 GTGGGATTGCTGAGGGGGCAGGG - Intronic
920720772 1:208384768-208384790 CTGTGAAAGTTGAGGCTGCAGGG + Intergenic
922510314 1:226160679-226160701 CTGAGTTTGTAGGGGTGGCATGG - Intronic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
1062817535 10:511686-511708 CCTTCATTGTTGAGGTGACAGGG - Intronic
1063070705 10:2660379-2660401 CAGTGACTGTCGAGGTCGCAGGG - Intergenic
1065079086 10:22110326-22110348 CTGTGCTTATTCAGGAGGCAAGG - Intergenic
1067946696 10:50693943-50693965 TTTTGATTGTTGAAGTGGCCTGG + Intergenic
1068807524 10:61215510-61215532 GTGTGATTGTTGACTTGGCAGGG - Intergenic
1069146305 10:64896115-64896137 CTGCTCTTGTGGAGGTGGCAGGG + Intergenic
1070155857 10:73834882-73834904 CAGTGACTGTTGAGGTGGAGGGG - Intronic
1070882004 10:79858936-79858958 TTTTGATTGTTGAAGTGGCATGG + Intergenic
1071648578 10:87375247-87375269 TTTTGATTGTTGAAGTGGCATGG + Intergenic
1072524573 10:96259904-96259926 CTGAGACTGATGAGATGGCAAGG + Intronic
1072732648 10:97857971-97857993 ATGAGATTGTAGAGGAGGCAAGG - Intronic
1073043058 10:100620537-100620559 CTTTGATTGATGAGTTGGGAAGG - Intergenic
1073099389 10:100999069-100999091 CAGTGATTGTTGGGGAGCCAGGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1077964236 11:7110679-7110701 CTGCTCTTGTGGAGGTGGCAGGG + Intergenic
1078428259 11:11268564-11268586 CTGTGAGTGTTGAAGAGGCTTGG + Intergenic
1079685060 11:23349407-23349429 CTTCGATTTTTGAGGTGGTATGG - Intergenic
1081674414 11:44960249-44960271 CTGTGAGAGTGGAGGTGGTAAGG + Intergenic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085023360 11:73222571-73222593 CTGTGGAGGGTGAGGTGGCATGG - Intronic
1086833057 11:91589367-91589389 CTGTGATTGTTTTGGTAGTATGG + Intergenic
1088047882 11:105475336-105475358 CACTAATTGTTGAGGTAGCATGG - Intergenic
1089284021 11:117394286-117394308 CTGTGATTTTTGTGGTAGAAGGG + Intronic
1089455423 11:118622863-118622885 CTCTGATTGGTGACTTGGCAGGG + Intronic
1092677804 12:10942107-10942129 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1093171055 12:15861032-15861054 CTGTGAATGATGAGGAGGAAGGG - Intronic
1093991468 12:25593314-25593336 CTGTTCTGGTGGAGGTGGCAGGG - Intronic
1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG + Intergenic
1096956897 12:55535108-55535130 CTGTTCTGGTGGAGGTGGCAAGG - Intergenic
1097026339 12:56058527-56058549 CACAAATTGTTGAGGTGGCATGG - Intergenic
1097067025 12:56328180-56328202 CTGAGGTTGTTGCGGGGGCAGGG - Intronic
1098232196 12:68383248-68383270 CTGTCAATGGAGAGGTGGCATGG - Intergenic
1099477111 12:83121540-83121562 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1099687391 12:85907796-85907818 CTGTTCTGGTGGAGGTGGCATGG + Intergenic
1100203548 12:92325137-92325159 CTGTTATGGTGGAGGTGGCAGGG + Intergenic
1101635217 12:106535191-106535213 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1101778820 12:107817445-107817467 CTGTGGTGGCTGAGGTGGAATGG + Intergenic
1102506895 12:113389405-113389427 CTGTGCTTCTTGGGGTGGCAGGG + Exonic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1107755948 13:43622632-43622654 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1107986455 13:45780621-45780643 CTGGGATAGTTGAGGGAGCAGGG - Exonic
1108999436 13:56779389-56779411 CTGTGATTGTTCAGCTCACAGGG - Intergenic
1113496176 13:110731037-110731059 CTGTGATTGTTGCGCTGCCTTGG - Intergenic
1114221003 14:20696442-20696464 CTGTGATTGTTGGCTTTGCAAGG + Intronic
1114939086 14:27583587-27583609 CTGAGTTAGTTTAGGTGGCAGGG + Intergenic
1115996971 14:39204461-39204483 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1116601690 14:46933544-46933566 CTTTTGTTGTTGGGGTGGCAAGG - Intronic
1119677093 14:76563875-76563897 ATGTGATTGTGGGGCTGGCAGGG + Intergenic
1121865039 14:97355007-97355029 TGTTGATTGTTGAGATGGCAAGG - Intergenic
1121867019 14:97372116-97372138 CTGTGAATGTCAAGGTGTCATGG - Intergenic
1122678551 14:103437835-103437857 CTTTCATTGTAGAGGTGACAGGG + Intronic
1123901681 15:24883460-24883482 GTGTGTTTGTTGAGGGGGTAGGG - Intronic
1129227116 15:74176478-74176500 CTGTGACTGTCAAGCTGGCAAGG + Exonic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1135055872 16:19231667-19231689 CTGTTATGGCTGAGGTGGGAGGG + Intronic
1135063846 16:19292641-19292663 GTGTGAATGTTGAGGTGCAAGGG + Intronic
1137826201 16:51497971-51497993 GTGTGCATGTTGAGGGGGCAGGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139365412 16:66429435-66429457 CTGGGATCCTGGAGGTGGCAAGG + Intronic
1139985209 16:70893230-70893252 CTGTGCTCTTTGAGGTTGCATGG - Intronic
1140566326 16:76047008-76047030 TTGTGATTGTTGAGAAGCCACGG + Intergenic
1141237773 16:82235196-82235218 CTGTCATTTGTGAAGTGGCATGG + Intergenic
1141267002 16:82506700-82506722 CTGTGCTGGTTGAATTGGCAGGG - Intergenic
1141280462 16:82626491-82626513 TTGTGATTTGTGAGATGGCAGGG + Intergenic
1141742982 16:85906551-85906573 CTGTGATGGATGATGTGGCCTGG + Intronic
1148734248 17:49855842-49855864 CTGTTATTGTTGATTTTGCAGGG - Intergenic
1149129469 17:53280648-53280670 CTGAGATTTTTGAGATGGAATGG - Intergenic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1150865215 17:68842034-68842056 ATGTGATTGCTGGGGTGGCTGGG + Intergenic
1151409426 17:73911976-73911998 ATGTGACTTTTGATGTGGCATGG - Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152288980 17:79428216-79428238 CTGTGACTGTGGAGATGGGAGGG - Intronic
1153168928 18:2293204-2293226 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1153328251 18:3844255-3844277 CTCTGATTTTTCAGGTGACATGG + Intronic
1157218649 18:45807483-45807505 CTGTTCTAGTGGAGGTGGCAGGG - Intergenic
1157623613 18:49030398-49030420 CTGTGAATGATGAGGTGACGGGG - Intergenic
1158732485 18:60039681-60039703 ATGTCATTGTTGAGGTTACACGG + Intergenic
1159787134 18:72727463-72727485 CTGTTTCTGTGGAGGTGGCAGGG - Intergenic
1162970068 19:14175404-14175426 CTGTGAGTGGTGAGGTGGATGGG - Intronic
1163758951 19:19122665-19122687 CTGTGAAGGCTGAGGTGGGAAGG + Intronic
925343368 2:3151762-3151784 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
927255858 2:21040382-21040404 CTGTGATTGAGGATGAGGCAGGG + Intronic
927363449 2:22264508-22264530 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
928407961 2:31029302-31029324 CAGTGAATGTAGAGGTGGCAGGG - Intronic
931993073 2:67810076-67810098 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
932700688 2:73989254-73989276 CTGTGACTGTTCAGGTGGGGCGG + Intronic
933299383 2:80525229-80525251 CTGTGTGTGTTGGGGAGGCAGGG - Intronic
937173249 2:119899059-119899081 ATGTGATGGTTAAGGTGGGAAGG + Intronic
940217579 2:151316109-151316131 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
941644659 2:168027077-168027099 CTGAGTTTGTTGAGGTTGGAGGG + Intronic
942505361 2:176637003-176637025 CATTGAGTTTTGAGGTGGCAGGG - Intergenic
945364945 2:208941025-208941047 CTGTGATATTTGAGGTCGGAGGG - Intergenic
946823830 2:223656346-223656368 CAGTGATTGTCTGGGTGGCAGGG + Intergenic
947581670 2:231323505-231323527 CTGCGCTAGTTGAGGTGGGAAGG - Intronic
948078438 2:235185538-235185560 CTGTGATTCTGGAGGTTGCCTGG - Intergenic
948793937 2:240392652-240392674 GGGTCATTGTTGCGGTGGCAGGG - Intergenic
948975039 2:241458844-241458866 CTGTGAGTCATGACGTGGCATGG + Intronic
1169213365 20:3779588-3779610 CTGAGACTGTTTTGGTGGCAGGG - Intronic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1169401370 20:5283243-5283265 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1169717638 20:8638333-8638355 TTGAGATTGTAGAGGTGACAGGG + Intronic
1172454995 20:35063566-35063588 CTGTTATTGCTGGGGAGGCAGGG + Intronic
1173998011 20:47354300-47354322 CTGTGTTTGTTGGGCTGGAAGGG - Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1177696294 21:24576967-24576989 CTGTGAATGTTGATGTGGGCTGG + Intergenic
1183139980 22:35928240-35928262 CTGTGTCTGTTGGGGGGGCAGGG + Intronic
1184373963 22:44100003-44100025 CAGCGATTGTGGGGGTGGCAGGG - Intronic
949688621 3:6608273-6608295 CTTTTATTTTTGAGGGGGCAAGG + Intergenic
949725436 3:7039193-7039215 CTGTGATTGTGGAGTTTGCATGG + Intronic
950223357 3:11213589-11213611 CTGTGATGGAAGAGGTGGAAGGG + Intronic
950603501 3:14057510-14057532 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
951183845 3:19689059-19689081 CTGTTCTGGTAGAGGTGGCAGGG - Intergenic
953382269 3:42480877-42480899 CTGCTCTTGTAGAGGTGGCAGGG - Intergenic
953534762 3:43769375-43769397 CTGGGATTGTGCAAGTGGCAGGG - Intergenic
954248770 3:49352502-49352524 CTGAGATGGTGGGGGTGGCATGG + Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
957745890 3:84341743-84341765 CTGTGAAGTTTGAGGTGGAATGG - Intergenic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
958982105 3:100733747-100733769 CTGTTATTGTTGATCTAGCAGGG + Intronic
959997329 3:112693730-112693752 TTGTGCTGGTGGAGGTGGCAGGG - Intergenic
960936931 3:122910192-122910214 CTGTGTTTGTTCAGGGGGCTTGG + Exonic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962365030 3:134773100-134773122 CTGTGCTTGTAGAGGCAGCAGGG + Intronic
962399205 3:135042624-135042646 CTGAGTTTGTTGAGTTTGCAAGG + Intronic
962401796 3:135067076-135067098 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
963751064 3:149180475-149180497 CTGGGATTGGTGAGTGGGCATGG - Intronic
963769912 3:149379071-149379093 CTGTGGTTAGTGATGTGGCATGG + Intergenic
963920065 3:150896765-150896787 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
964442330 3:156725174-156725196 ATGTGAGTGTTGAGGTGGTCCGG - Intergenic
964722665 3:159782873-159782895 CTGGGTGTGTTGAGGTGGCAAGG - Intronic
964741676 3:159972957-159972979 CTGAGATTGTTTTGGTAGCATGG - Intergenic
965561662 3:170067619-170067641 CTGTGATTGCAGAGGTCACATGG - Intronic
965874331 3:173299173-173299195 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
965952096 3:174322087-174322109 CTGTGATATTTGATGTAGCATGG + Intergenic
966744507 3:183262938-183262960 CTGGGGTTGTTGGGGTGGGAGGG + Intronic
966962283 3:184952402-184952424 TTGTGATTCTTCAGTTGGCAAGG - Intronic
967388099 3:188929816-188929838 CTGTGAGTGTGGGGGTAGCACGG - Intergenic
967807666 3:193729873-193729895 CAGTGATTGTAGGGGAGGCAGGG + Intergenic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
969349055 4:6587563-6587585 CTGTGATTCTTCAGGTGTGAGGG + Intronic
972727739 4:41760221-41760243 CTGTGATTTTTGTGGTATCATGG + Intergenic
973069107 4:45835374-45835396 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
973670545 4:53212619-53212641 CTGTGTGTGTTGACGTGGAAGGG + Intronic
973831510 4:54764544-54764566 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
974660609 4:64883500-64883522 CTGTGGTTTATGAGGTGGAAAGG - Intergenic
974998638 4:69194316-69194338 CCATGTTTGTTGAGCTGGCATGG - Intronic
976382321 4:84413703-84413725 CTGTGAGTTCTGAGGAGGCAGGG - Intergenic
976541016 4:86276359-86276381 CTGTGAGTGATGAGATGGAAGGG - Intronic
978999375 4:115199124-115199146 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
979267593 4:118721272-118721294 CTGTAATTGTAGAGATGGCAGGG + Intergenic
979514351 4:121589928-121589950 CTGAGATACGTGAGGTGGCATGG + Intergenic
981007864 4:139894076-139894098 ATGTGAGTGTTCAGGTGTCAGGG - Intronic
981011959 4:139934339-139934361 TTGTGAGTGTTGAGGAGGGAGGG + Intronic
982218721 4:153106800-153106822 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
982312106 4:153997063-153997085 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
991117429 5:62970314-62970336 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
993031917 5:82714998-82715020 CGGTGCTTGTTGAGGAGGCTCGG - Intergenic
995921639 5:117321698-117321720 AAGTGGTTGGTGAGGTGGCAGGG - Intergenic
996288897 5:121828739-121828761 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
999499226 5:152130171-152130193 CTGTGGTTATTGTGGTGGGAGGG - Intergenic
1000360864 5:160446131-160446153 CTTTGATTCTTGATGTGGCTGGG + Intergenic
1001244582 5:170096320-170096342 CTGTCAGTGTTGGAGTGGCAAGG - Intergenic
1003104995 6:3208638-3208660 GAGTGATGGATGAGGTGGCAAGG + Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1005809312 6:29504003-29504025 CTGAGCTTGAAGAGGTGGCATGG + Intergenic
1005955638 6:30661577-30661599 CTGTGAGAGTTGAGGTAGAAAGG - Intronic
1008899387 6:56594256-56594278 CTGTCAGTCTTGAGGCGGCAAGG - Intronic
1009968879 6:70605253-70605275 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1010478429 6:76318893-76318915 ATGTGATTGTGGTGTTGGCAGGG + Intergenic
1010492668 6:76493669-76493691 CTGTGTTTGTTGAGCCGGCTTGG + Intergenic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1011168679 6:84479754-84479776 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1013262249 6:108456425-108456447 ATGTGATTGTTGATATGGCTGGG + Intronic
1014531339 6:122563350-122563372 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1015663259 6:135600126-135600148 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1017534203 6:155329112-155329134 CTTTAAATGTTGAGGTGGGAAGG - Intergenic
1017732752 6:157332464-157332486 CTGTGATTGTGGTAGTAGCATGG + Intergenic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1018143043 6:160858819-160858841 CTCTGGTTGGTGGGGTGGCAGGG - Intergenic
1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG + Intergenic
1020644681 7:10800416-10800438 CAGTGCCTGTTGAGTTGGCAGGG - Intergenic
1025295221 7:57771215-57771237 TTGTGCTCGTGGAGGTGGCACGG + Intergenic
1026854555 7:73744389-73744411 ATGTGATTCTTAAAGTGGCAGGG + Intergenic
1027699273 7:81449649-81449671 CTGTTCTGGTCGAGGTGGCAGGG - Intergenic
1027963807 7:84980730-84980752 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1028235243 7:88353333-88353355 CTATGCTTGCTGTGGTGGCATGG + Intergenic
1029512187 7:101002755-101002777 CAGTGCTTGTGGAGCTGGCAGGG - Exonic
1030325259 7:108212002-108212024 CTGTTCTGGTGGAGGTGGCAGGG - Intronic
1031391054 7:121215566-121215588 CTTTGGTTGTTGATGTAGCAAGG + Intronic
1031401420 7:121329386-121329408 ATGTGAGTATGGAGGTGGCAGGG + Exonic
1031554037 7:123149477-123149499 CTGTGATGGTACAAGTGGCAGGG + Intronic
1032432808 7:131875887-131875909 CTGTGCATGTTGAAGTGGTATGG - Intergenic
1034683144 7:152946711-152946733 CTGTTCTGGTGGAGGTGGCATGG + Intergenic
1035318107 7:158010082-158010104 CTGTCCTTGTGGAGGAGGCAGGG + Intronic
1039138205 8:34351649-34351671 CTGTGATTCTTGAGGTTGCGTGG + Intergenic
1039363068 8:36901226-36901248 CTGTGCTAGTTCAGGAGGCATGG - Intronic
1039571884 8:38593310-38593332 CTGTAACGGTGGAGGTGGCAGGG - Intergenic
1039683982 8:39776267-39776289 CTCTGATTTTTGGGGTGGCAGGG - Intronic
1041570493 8:59332801-59332823 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1046604103 8:116351541-116351563 CTGTGGTTGAAGAGGTGGCGAGG - Intergenic
1048029230 8:130615496-130615518 ATTTGATTGGTGAGGTGGGAGGG - Intergenic
1050018869 9:1263269-1263291 CTGTTCTGGTTGAGGTGGCTGGG + Intergenic
1050912077 9:11083870-11083892 TTGTGAGTGTTTAGGTGCCAAGG - Intergenic
1051362731 9:16295169-16295191 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1052537189 9:29761889-29761911 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1052687433 9:31773593-31773615 CTGTGTTTGTTGAGCTGGCTTGG - Intergenic
1052982426 9:34458691-34458713 CTGTGATTCCTGAGGGGGCGGGG + Intronic
1053104336 9:35397339-35397361 CTGTGAGTGTGGTGGTGGTAAGG - Intronic
1055839632 9:80487334-80487356 CTGTGATATTTGAGGTGTGAAGG - Intergenic
1056309504 9:85324767-85324789 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1057293966 9:93824751-93824773 CTGTGAATTTTGAGGTGAAAAGG - Intergenic
1059199000 9:112397092-112397114 CTGTGTTTGTTGAGCTGGCTTGG + Intronic
1059602365 9:115793708-115793730 GTGTGACTGTTGAGATGGCCTGG - Intergenic
1060109985 9:120899953-120899975 GTGTGAATGTTGAGTTGGAATGG + Intergenic
1060124590 9:121030665-121030687 CTCTGATTGTTGGAGTGGGAAGG - Intronic
1060409575 9:123391078-123391100 CTGTGATGGTGGAGGGGGCTGGG + Intronic
1187773553 X:22730228-22730250 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1190895424 X:54613798-54613820 CTGTTCCTGTGGAGGTGGCAGGG + Intergenic
1191080409 X:56504588-56504610 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1191080696 X:56506372-56506394 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1191711190 X:64151604-64151626 CTGAGAATGTTGTGGTGCCAGGG - Intergenic
1192929629 X:75792165-75792187 CTGTCCTGGTGGAGGTGGCAGGG - Intergenic
1193680926 X:84518358-84518380 CTGTTTTGGTGGAGGTGGCAGGG + Intergenic
1193785958 X:85760219-85760241 CTGTTCTGGTGGAGGTGGCAAGG + Intergenic
1194701439 X:97119439-97119461 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1196948225 X:120849976-120849998 CTGTTTTGGTGGAGGTGGCAGGG + Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1198770267 X:140123405-140123427 CTGCTATGGTGGAGGTGGCAGGG + Intergenic
1200384883 X:155880640-155880662 CTGTGTTTGATGAGGGGGCTTGG + Intergenic
1200816614 Y:7539934-7539956 CTGAGATTCTTGAGGTTACAGGG + Intergenic
1200971075 Y:9153080-9153102 GAGTGATTCTTGAGGTGGGAGGG - Intergenic
1202139949 Y:21711223-21711245 GAGTGATTCTTGAGGTGGGAGGG + Intergenic