ID: 901372895

View in Genome Browser
Species Human (GRCh38)
Location 1:8815894-8815916
Sequence CTGTTGTTGTTGAGGTCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901372895_901372901 12 Left 901372895 1:8815894-8815916 CCCTTCGACCTCAACAACAACAG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 901372901 1:8815929-8815951 GCCAGCTTTCCACCCATCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901372895 Original CRISPR CTGTTGTTGTTGAGGTCGAA GGG (reversed) Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
901399453 1:9005989-9006011 CTGCTGTTGTTGTGGTGGACAGG - Intronic
906902576 1:49852121-49852143 TTGTTGTTGTTAGGGTAGAAGGG - Intronic
908141352 1:61188348-61188370 ATGTTTTTGTTGAGCTCGGAGGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
911528039 1:99009160-99009182 CTGTTGTTGTTGTTGTTTAAAGG - Intergenic
914095479 1:144540757-144540779 TTGTTGTTGTTGAAGCAGAATGG + Intergenic
914303046 1:146393139-146393161 TTGTTGTTGTTGAAGCAGAATGG - Intergenic
914516684 1:148380079-148380101 TTGTTGTTGTTGAAGCAGAATGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
1066756622 10:38718523-38718545 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
1069816160 10:71195887-71195909 TTGTTGTTGTTGGAGTTGAATGG - Intergenic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1071962106 10:90817061-90817083 ATGTTGTTGCTGAGGTGGTATGG - Intronic
1078281687 11:9908696-9908718 CTGTTGTTGTTGTTTTAGAAAGG + Intronic
1081479001 11:43466410-43466432 CTGTTGATGGTGATGTTGAAGGG - Intronic
1083861476 11:65422498-65422520 CGGATGTTGTTGAGGTCGGGCGG - Intergenic
1084049629 11:66591405-66591427 CTGTTTTTCTTGACGTAGAAAGG + Exonic
1085501054 11:77024359-77024381 CTGGTGTTGTTGAGGTCCTTGGG + Exonic
1090463709 11:126913946-126913968 TTGTTGTCCTTGAGGTGGAAAGG - Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1095909255 12:47409180-47409202 CTGTTGGTGTCGGGGTGGAAGGG + Intergenic
1096099473 12:48960725-48960747 TTGTTGTTGTTCATGTCAAATGG + Intergenic
1096241763 12:49963483-49963505 GTGTTGTTGTTGAGCTGCAAGGG - Exonic
1096249462 12:50019493-50019515 ACGTTGATGTTGAGGTAGAATGG - Intronic
1096739645 12:53683202-53683224 CTATTGTTGATGAGGTTGAGTGG + Intergenic
1101778820 12:107817445-107817467 CTGTGGTGGCTGAGGTGGAATGG + Intergenic
1110632900 13:77730110-77730132 CTGTTGTGGTTGGGGTGTAATGG + Intronic
1111177612 13:84617463-84617485 CTGTTGTTGTTGATGTCCTTTGG - Intergenic
1113141132 13:107150672-107150694 TTGTTGTTGTTGAGTTAAAAGGG + Intergenic
1115587248 14:34826989-34827011 CTGGAGTTGTTGATGTCCAAAGG - Intronic
1116601690 14:46933544-46933566 CTTTTGTTGTTGGGGTGGCAAGG - Intronic
1118172982 14:63407755-63407777 CTTTTGGTGTTGAGGTCATAAGG + Intronic
1118657017 14:67962601-67962623 AAGTTGTTGTTGAGGTATAAAGG + Intronic
1123440887 15:20290586-20290608 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
1124042788 15:26120370-26120392 TTGTTGTTATTGACTTCGAAAGG + Intergenic
1125085941 15:35729345-35729367 CTGCTGTTGTTCATGTCGAAGGG + Intergenic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1126863548 15:52912557-52912579 CTGGTGTTGGGGAGGTGGAATGG + Intergenic
1127249361 15:57214323-57214345 CTGTTCATGTTGATGTCGGAGGG + Intronic
1133118563 16:3592346-3592368 CTGCTGTTGTTCAGGTCTAGTGG + Intronic
1135964144 16:27021971-27021993 TTGTTGTTGTTGAGATGGACGGG + Intergenic
1136725967 16:32357801-32357823 TTGTTGTTGTTGTTGTTGAATGG - Intergenic
1136844299 16:33563850-33563872 TTGTTGTTGTTGTTGTTGAATGG - Intergenic
1138879096 16:60988997-60989019 GTGCTGTTGTTGATGTTGAATGG + Intergenic
1203000465 16_KI270728v1_random:159955-159977 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
1203132066 16_KI270728v1_random:1696358-1696380 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
1203154465 16_KI270728v1_random:1864149-1864171 TTGTTGTTGTTGTTGTTGAATGG - Intergenic
1143019263 17:3908197-3908219 CTGCCGGTCTTGAGGTCGAAGGG + Intronic
1145943585 17:28757458-28757480 TTGTTTTTGTTGAGGGGGAAAGG + Exonic
1149637405 17:58181992-58182014 CTGTTGATGTTGATGTCGGCTGG + Intergenic
1150291903 17:63987208-63987230 CTGTTGCTGATGAGGCAGAATGG + Intergenic
1156252445 18:35364094-35364116 CTGTTGTTGTTGAGTTGGAGGGG + Intergenic
1157111709 18:44826641-44826663 CTGTTGTTGTCGTTGTTGAAGGG + Intronic
1158252738 18:55507670-55507692 CTGTTGCTGTTCAGGTGCAAAGG - Intronic
1159793024 18:72807847-72807869 CTGTTGTTGTTTCTGTCCAAGGG + Intronic
930005927 2:46896545-46896567 ATGTTGTTGCTCAGGTCGCAAGG + Intergenic
932170133 2:69547398-69547420 TTGTTGTTGTTGAGTTGTAAGGG - Intronic
932591419 2:73070411-73070433 TTTTTGTTGTTGTGGTGGAAGGG - Intronic
934319917 2:91962774-91962796 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
937781485 2:125843583-125843605 CTGTTGTTGTTAAGATGGGAGGG + Intergenic
938190997 2:129280604-129280626 CTGCTGTTGTTGAAGTTGAAGGG + Intergenic
942119954 2:172766686-172766708 CTGTTGGTGTTGATGAAGAAAGG - Intronic
942488980 2:176470832-176470854 CTGTGGTTGATGAGGTCTAGTGG - Intergenic
943562741 2:189483280-189483302 TTGTTGGGGTTGAGGTCGGAGGG + Intergenic
945285076 2:208074048-208074070 TTGTTGTTGTTCAGGTTGGATGG + Intergenic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
1170693005 20:18631906-18631928 CTCTTCTTGTTTAGGTCAAAGGG + Intronic
1175559215 20:59904982-59905004 ATGTTGGTGTTGAGGGTGAAGGG - Intronic
1177279169 21:18956855-18956877 CTCTTCTTGTTGAGGTTGAGGGG + Intergenic
1182070589 22:27460963-27460985 CTTTTGTTCCTGAGGTCGCAGGG + Intergenic
1182212540 22:28688717-28688739 TTGTTGTTGTTGTTGTTGAATGG - Intronic
1184320131 22:43735356-43735378 CCGTTGTTGCTGAGGTGGAGGGG - Intronic
953187143 3:40648649-40648671 ATGTTGTTGTTGAGGTAGTGTGG + Intergenic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
961706517 3:128790890-128790912 TTGTTGTTTTTGAGGTGGGAAGG - Intronic
963357564 3:144229153-144229175 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
963655993 3:148050593-148050615 TTGTTGTGGTAGAGGTTGAAAGG - Intergenic
964711638 3:159677326-159677348 CTGTTGATGTTGAGTATGAATGG + Intronic
964825834 3:160827187-160827209 CTAATGTTGCTGAGGTCGATAGG + Intronic
967374845 3:188789288-188789310 TTGTTGTTGTTGTTGTTGAACGG + Intronic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
974660609 4:64883500-64883522 CTGTGGTTTATGAGGTGGAAAGG - Intergenic
976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG + Intergenic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
981223245 4:142261515-142261537 CTTTTGGTGATGAGGTCTAAGGG + Intronic
998615593 5:143736708-143736730 CTGTTGTTGTTGAACTTGCATGG - Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1007695473 6:43730028-43730050 TTGTTGTTGTTGTTGTTGAATGG - Intergenic
1008026157 6:46638321-46638343 TTGTTGTTGTTGCTGTCTAAAGG - Intronic
1008436014 6:51477540-51477562 TTGTTGTTGTTGTGGAAGAAGGG - Intergenic
1011883844 6:92066525-92066547 CTGTTGTTGTTGTTGTCCTATGG - Intergenic
1012975138 6:105772636-105772658 AAGTTGTTGGTGAGGTTGAATGG - Intergenic
1018254825 6:161907704-161907726 CTGTATTTGCTGAGATCGAAAGG + Intronic
1019863021 7:3677927-3677949 CTGTTGTTGTTGAGTTGTAGGGG - Intronic
1020226531 7:6284815-6284837 TTGTTGTTGTTGTTGTTGAACGG + Intergenic
1020433814 7:8140776-8140798 CTTTTGTTGTTGTTGTTGAAAGG + Intronic
1023488639 7:40713629-40713651 CTGTTGTGGTTAAGGCCCAAAGG - Intronic
1026567044 7:71497757-71497779 CTGTTGTTGCTGATATTGAATGG + Intronic
1029150862 7:98479455-98479477 CTGTTTTTGTTAGGGTCCAAGGG + Intergenic
1029715525 7:102323371-102323393 CTGTTCTTGTTGGAGTGGAATGG - Intergenic
1030090229 7:105851714-105851736 TTGTTGTTGTTGTTGTTGAAAGG + Intronic
1030359861 7:108583612-108583634 CTGATGCTGTTGAGGTCCCAAGG + Intergenic
1030947634 7:115744139-115744161 TTGTTGATGTTTAGGTTGAATGG + Intergenic
1032896434 7:136255938-136255960 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
1035552830 8:543794-543816 CTGATGCTGTTAAGGCCGAATGG - Intronic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036759275 8:11496191-11496213 TTGTTGTTGTTGGTGTCCAATGG + Intronic
1043159692 8:76830159-76830181 ATGTTGTTGTTGATGGCGATTGG + Intronic
1048435757 8:134415759-134415781 CTTTTGTTGTTGTGGTCCAGAGG + Intergenic
1048490185 8:134885084-134885106 CTTGTCTTGTTGTGGTCGAAGGG + Intergenic
1048616786 8:136083510-136083532 GTTATGTTGTTGAGGTCGTATGG + Intergenic
1048707081 8:137165743-137165765 TTGTTGGTGTTGAAGTGGAATGG + Intergenic
1048721392 8:137329508-137329530 TTGTTGTTGTTGATGTCTCATGG - Intergenic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1052112141 9:24599425-24599447 TTGTTGTTGTTGTTGTTGAAGGG - Intergenic
1052299488 9:26937354-26937376 TTGTTGTTGTTGTTGTTGAAGGG - Intronic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1056118641 9:83465147-83465169 ATATTGTTGGTGAGATCGAATGG - Intronic
1059124490 9:111671053-111671075 CTGTTGTTGTTAAGACAGAATGG - Intergenic
1059676365 9:116544351-116544373 CTTTTTTTGGTGAGGTGGAATGG - Intronic
1061899102 9:133663908-133663930 CTCTTGTTGTTGGGGTCGAAGGG + Exonic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1190414101 X:50164350-50164372 TTGTTGTTGTTGTTGTCGAAAGG + Intergenic
1196665839 X:118315261-118315283 CTGTTTCTGTTGAGTTAGAAAGG - Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1199662211 X:150063355-150063377 CTGTTGGTTTTGTGGTGGAATGG + Intergenic
1201187443 Y:11417870-11417892 TTGTTGTTGTTGTTGTTGAATGG + Intergenic
1202068556 Y:20966770-20966792 ATCTTGTAGTTGAGGTTGAAGGG - Intergenic