ID: 901372978

View in Genome Browser
Species Human (GRCh38)
Location 1:8816848-8816870
Sequence CATTATTGGCTGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901372978 Original CRISPR CATTATTGGCTGAAACTGGA AGG (reversed) Intronic
901372978 1:8816848-8816870 CATTATTGGCTGAAACTGGAAGG - Intronic
902698789 1:18157654-18157676 CATTAGTGGCTGCAGCTGGGAGG - Intronic
909685138 1:78339437-78339459 CAGTATTTGCTGAAAGTAGAAGG - Intronic
914908479 1:151766101-151766123 CATTCTTGCATGGAACTGGATGG + Intronic
918354469 1:183693756-183693778 CTTTACTGCCTGAAACAGGAAGG - Intronic
918789283 1:188805384-188805406 GATTATTGCTTGAACCTGGATGG - Intergenic
920805238 1:209227473-209227495 CATTATTGGCAAAGACTAGAAGG - Intergenic
921216494 1:212942052-212942074 CATTATTAGGTGAAACAGAAAGG + Intergenic
922277977 1:224096849-224096871 TATTATAGGATAAAACTGGATGG - Intergenic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
1064171512 10:13037858-13037880 CCTTAGTTGGTGAAACTGGATGG + Intronic
1065163269 10:22946136-22946158 CATTAATGGGTCAAACTGAAAGG - Exonic
1067214298 10:44288118-44288140 CATTATTTGCTGAAACAAAAAGG - Intergenic
1069322722 10:67192953-67192975 CATTTGTGGATGAACCTGGAGGG + Intronic
1069340210 10:67401260-67401282 CAGTATATGCTGAAACTGGGTGG - Intronic
1080182154 11:29438352-29438374 CATAATAAGCTCAAACTGGAAGG + Intergenic
1080622619 11:33999278-33999300 CATTCTTGGCTGGCACTGGAAGG - Intergenic
1085607268 11:77912977-77912999 CATTATTACCTGAAACAGAAGGG - Intronic
1086230547 11:84564454-84564476 CCTTATTGGGTGAGACTGCAAGG + Intronic
1086380115 11:86244280-86244302 CACTATTGGTAGCAACTGGAAGG + Intergenic
1089194695 11:116687379-116687401 CATTATTGGCACAGGCTGGATGG + Intergenic
1089737192 11:120557633-120557655 CATTCTCGTCTGAATCTGGAAGG + Intronic
1094456156 12:30635907-30635929 CTTTATTGGCTTATACTGTATGG - Intronic
1096999507 12:55864419-55864441 CAAAATTGGTTGAAATTGGATGG - Intergenic
1100118054 12:91333371-91333393 GATTGTTGACTGAAACTGTAAGG - Intergenic
1100418551 12:94405568-94405590 CTATCTTGGCTGAAAGTGGAAGG - Intronic
1104674253 12:130702025-130702047 GATTATTGACTGAAATTGGCTGG - Intronic
1106594973 13:31128021-31128043 CATTATTGGCTAAAACTCTGAGG + Intergenic
1108345986 13:49547579-49547601 CATTATTGGCTGAAAAAGCTAGG - Intronic
1109106483 13:58258444-58258466 AAATATTGGCTCAAACTGCATGG + Intergenic
1110573183 13:77027425-77027447 TATCTGTGGCTGAAACTGGAAGG + Intergenic
1111689514 13:91544877-91544899 CAGTCTTGGCTGGAGCTGGAGGG + Intronic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112713857 13:102160874-102160896 CATTTTGAGCTGAAACTGAATGG - Intronic
1113111206 13:106825873-106825895 CATTATTTGCTTGAACTGCAAGG + Intergenic
1113397959 13:109966114-109966136 CATCCTAGGCTGCAACTGGATGG - Intergenic
1113818718 13:113195070-113195092 CATTATTGGCAAACACTCGAAGG + Exonic
1115501517 14:34053931-34053953 TATTATTGGGTGGAACTGGCCGG - Intronic
1116252614 14:42506182-42506204 CAGTATTGGCAAAAACTGCAAGG - Intergenic
1117023462 14:51595789-51595811 CATTATTGCCTGAGACTCTAAGG - Intronic
1118126063 14:62905723-62905745 CATTGTTGGCTCACCCTGGAAGG - Intronic
1118544545 14:66872427-66872449 CATTTTAGGCTAAAACTTGAGGG - Intronic
1119251774 14:73161807-73161829 CATTATTAGCGGAAACTTGTTGG + Intronic
1120444375 14:84575956-84575978 CTTGATTGGCTGAAACTTGGTGG + Intergenic
1128684681 15:69674966-69674988 CATGATTGGCTCATACAGGATGG + Intergenic
1129112860 15:73348009-73348031 ACTTATAGGCTGACACTGGAGGG + Intronic
1130088629 15:80800429-80800451 CATTAATGGCTGAATGTGGCTGG + Intronic
1130864302 15:87919052-87919074 CATTATTGTCTGCCACTGCATGG - Intronic
1131989465 15:98079431-98079453 AATTATTGACTCAAACAGGAAGG - Intergenic
1133577454 16:7107354-7107376 TATTATTAGCTCAAACTGGAAGG + Intronic
1134802598 16:17099240-17099262 TACGATTGGCTGAACCTGGATGG - Intergenic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136905031 16:34081494-34081516 CATCATTGGGTGGAATTGGATGG + Intergenic
1136947282 16:34668234-34668256 CATTATCGGATGAAATTGAATGG - Intergenic
1137086675 16:36133572-36133594 CATTATTGGATGGAAGTGAATGG - Intergenic
1142384442 16:89753962-89753984 CAGAATTGCCTGAACCTGGAAGG + Intronic
1149253441 17:54796621-54796643 CATTCCTGTATGAAACTGGAGGG - Intergenic
1150075349 17:62187451-62187473 GAGAATTGGCTGAAACCGGAAGG - Intergenic
1150633761 17:66898489-66898511 CATTCTGGGCTGGAACTGGGTGG + Intergenic
1153318486 18:3748697-3748719 CATTAATGGCTTAAACTGAGAGG + Intronic
1153549655 18:6248300-6248322 CATTCTTGGATGACACAGGAGGG - Intronic
1157375925 18:47165000-47165022 CGTTTTTGGCTGAGCCTGGATGG - Intronic
1157922907 18:51732007-51732029 CTTTGTTTGCTGAAACTTGAAGG + Intergenic
1158626788 18:59078510-59078532 CAGGACAGGCTGAAACTGGAGGG + Intergenic
1163687045 19:18717637-18717659 CACTGTAGGCTGAGACTGGAAGG - Intronic
1164137933 19:22430723-22430745 CATTATTGACTAAATCTTGAAGG + Intronic
1164505936 19:28861201-28861223 CACTCTGGGCTGAGACTGGATGG - Intergenic
1166424807 19:42668241-42668263 CACTATTGGCTGCATCTGAATGG - Intronic
1166703390 19:44895029-44895051 AGTTTTTGGCTGGAACTGGAAGG + Intronic
1167586209 19:50377135-50377157 CTTTAGGGGCTGAACCTGGAAGG + Intronic
1167834890 19:52060410-52060432 CATTCTCTGGTGAAACTGGAAGG + Intronic
925940277 2:8810393-8810415 CATTATTACCTGATTCTGGAGGG + Intronic
927421893 2:22942751-22942773 CATTATCTGCTGAAACAAGAAGG + Intergenic
928646592 2:33359838-33359860 CATTATTATCTGAAAGTGGGTGG + Intronic
928796473 2:35027897-35027919 CATTAGGGGGTGAAACTGGTCGG - Intergenic
931342274 2:61413299-61413321 CAGAATTGCCTGAACCTGGAAGG + Intronic
931930748 2:67130736-67130758 GATTAATAGCTGAAAATGGAGGG + Intergenic
933303099 2:80565092-80565114 GAATATTGGATGAAACTGGGTGG + Intronic
933310181 2:80651152-80651174 CATTTTTGGCTGCAGCAGGATGG + Intergenic
935774179 2:106456575-106456597 AACTATTGTCTGAAAGTGGAAGG - Intronic
935868642 2:107420346-107420368 CATTCTTGTCTTAAACTGCAGGG + Intergenic
935905888 2:107839338-107839360 AACTATTGTCTGAAAGTGGAAGG + Intronic
936853164 2:116925972-116925994 CATTATTGGCAGTTACAGGAGGG - Intergenic
938850380 2:135253410-135253432 CACCATAGGCTGAAACTAGATGG + Intronic
941118921 2:161506051-161506073 TCTTCTTGGCTTAAACTGGAAGG + Intronic
942703483 2:178740600-178740622 CTTTATTAGCTGAACCTGAAGGG - Exonic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1170362460 20:15561422-15561444 CATTTTGGGCTGAATCTGGCTGG + Intronic
1170657095 20:18298081-18298103 CATTACTGGCTGTAACAGGATGG + Intronic
1171953829 20:31443926-31443948 CATTATTAGATGAACCTGGGGGG - Intronic
1173173638 20:40747362-40747384 CATTATGGGATGAAAGAGGAGGG - Intergenic
1176978500 21:15352007-15352029 CGCTATTGGCTGAAAACGGAAGG + Intergenic
1178050335 21:28739976-28739998 AATTATTGGCTGAAACTTGATGG - Intergenic
1181787421 22:25237273-25237295 TCCTATCGGCTGAAACTGGAAGG + Intergenic
953121537 3:40047595-40047617 TATTATTGGCTGAAACCCAAAGG + Intronic
955104684 3:55885835-55885857 CATTACAGGAGGAAACTGGAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956407835 3:68947501-68947523 CAATATTCGCTGAATCTGGCTGG - Intergenic
957449812 3:80365223-80365245 CATTTTAGGCTTAAACTAGAAGG - Intergenic
959673049 3:109001220-109001242 GATAATTGCTTGAAACTGGAAGG - Intronic
961529454 3:127531758-127531780 CACCCTTGGCTGAAACTGGGTGG - Intergenic
961702225 3:128754263-128754285 CATTAATGGCTGAAAGGTGATGG + Intronic
962160483 3:132994356-132994378 TATTATTGGTTGAAAATAGATGG + Intergenic
963305183 3:143643772-143643794 CATTATTGGAAGAAAGTGGTTGG - Intronic
964290299 3:155171006-155171028 CCATCTTGGCTGAAAGTGGAAGG + Intronic
967895359 3:194391463-194391485 CAGTCTTGACTGAAACTGGGAGG + Intergenic
969971474 4:11052577-11052599 AATTATTGGCAGAAACTACATGG - Intergenic
972683195 4:41326758-41326780 CAATATTGGATGAACCTTGAAGG + Intergenic
975173020 4:71254789-71254811 CATGTAAGGCTGAAACTGGAGGG + Intronic
975407949 4:74013591-74013613 CATTGTAAGCTGACACTGGAAGG - Intergenic
975434722 4:74338104-74338126 CATTATTGTTTGAAACAGAATGG - Intergenic
978733601 4:112060403-112060425 CATCATTAGCTGCCACTGGATGG - Intergenic
978858673 4:113423355-113423377 GAGGATTGGCTGAGACTGGAAGG + Intergenic
980085419 4:128385606-128385628 CATGAATTGATGAAACTGGATGG + Intergenic
980666919 4:135952505-135952527 CATTATTGGCTGTGGCTGCAGGG + Intergenic
980782740 4:137512738-137512760 CTTTATTGGCTGGGAATGGAGGG - Intergenic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
983104317 4:163667272-163667294 CATTCTTGGCTGAAACTGCAAGG + Intronic
986665542 5:10100792-10100814 CATTATTGACTAAAACTGGGTGG + Intergenic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
989326331 5:40200036-40200058 CTCTCTTGCCTGAAACTGGAAGG + Intergenic
990794827 5:59528011-59528033 CATCATTGACTTTAACTGGATGG - Intronic
992432142 5:76719497-76719519 CAGAATTGCCTGAACCTGGAAGG + Intronic
993226741 5:85176161-85176183 AATAATTGGCTGAATCTGCAGGG + Intergenic
993369484 5:87074753-87074775 CTTTACTGGCTGAAATTGCATGG - Intergenic
994187037 5:96826595-96826617 CCATACTGGCTGAACCTGGATGG - Intronic
994454816 5:99992181-99992203 TATTATTGGCTTAAGCTGGGCGG - Intergenic
994993071 5:107022520-107022542 GATTCTGGGCTGATACTGGAAGG - Intergenic
995926487 5:117381302-117381324 CAGTATTGTCTCAAAGTGGAAGG - Intergenic
998956681 5:147446038-147446060 CATTGTTGGCTGAAACTCAGAGG - Intronic
1004482093 6:16030755-16030777 CATTACTGACTGAATTTGGAAGG - Intergenic
1006583626 6:35090946-35090968 CATTAGTGTCTGACGCTGGAGGG - Exonic
1008114768 6:47535657-47535679 CATTATTGCCTGAAGGTGGATGG + Intronic
1012713406 6:102637498-102637520 CATGATTGTCTGAAGCTTGATGG - Intergenic
1014273102 6:119355758-119355780 CTTAATTGGCTGGAACTGGCAGG + Intergenic
1014302173 6:119695125-119695147 GAGGATTGGTTGAAACTGGAAGG + Intergenic
1021242987 7:18227674-18227696 CATTATTAGTTGATACTGAAGGG - Intronic
1024288073 7:47777519-47777541 CCTAATTGACTGAAACTGCAAGG - Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1029140316 7:98404823-98404845 CATGATTGGCTGTACCTGGATGG - Intergenic
1033685116 7:143632635-143632657 TATTGTTGGCTGAGGCTGGAAGG - Intronic
1033688289 7:143711854-143711876 TATTGTTGGCTGAGGCTGGAAGG - Intronic
1033699498 7:143824986-143825008 TATTGTTGGCTGAGGCTGGAAGG + Intergenic
1033911643 7:146270255-146270277 CATTAATGGTTGAATATGGAGGG - Intronic
1034010157 7:147521062-147521084 CATTTTTGACTTAATCTGGAAGG - Intronic
1034063418 7:148113897-148113919 AATTAGTGTCTGAGACTGGAAGG - Intronic
1035109994 7:156473480-156473502 CATCAGTGGCTGGAATTGGAAGG - Intergenic
1035311978 7:157975193-157975215 CAGTGTTGGCAGGAACTGGAGGG - Intronic
1038774622 8:30517456-30517478 AATTAGTGGCTGAAGGTGGAGGG + Intronic
1039012499 8:33109896-33109918 CATAATTGCTTGAAACTGAATGG + Intergenic
1043744132 8:83852061-83852083 CATTATTGGCTGCATCTTCATGG + Intergenic
1043982019 8:86654156-86654178 GTTTATTGGCTGAGATTGGAAGG - Intronic
1044841024 8:96337147-96337169 CAGTAATGGCTGAGACTGGTGGG + Intergenic
1046244983 8:111547641-111547663 CATTAATGTCTGAAACTTTATGG - Intergenic
1046406018 8:113773690-113773712 CATTACTTGCTGAAGCTGAAGGG - Intergenic
1049627087 8:143629333-143629355 AAGTATAGGCTAAAACTGGAGGG - Intergenic
1050651389 9:7780687-7780709 CTTTGTGGGCTGAAACTGTAGGG + Intergenic
1052950883 9:34210195-34210217 CGTACTTGGCTGAAAATGGAAGG - Intronic
1056236413 9:84599020-84599042 CATTGTTGGCAGAAATTGGGTGG + Intergenic
1056283252 9:85062912-85062934 CCAAATTGGCTGAAACTGGAAGG - Intergenic
1056876011 9:90331431-90331453 GATTATTTTCTGAATCTGGAAGG - Intergenic
1187035365 X:15532914-15532936 CAGGTTTGGCTGAAACTGCAGGG - Intronic
1187554979 X:20343066-20343088 CACTATTGGCTGAGAGTGCAGGG + Intergenic
1189351560 X:40279517-40279539 TATGATGGGCTGAAAGTGGAGGG + Intergenic
1189401427 X:40672847-40672869 CATTATTGGATAAAACAGTATGG - Intronic
1189606892 X:42688067-42688089 CAATTTTGGCTGCAAGTGGAAGG - Intergenic
1189913630 X:45836060-45836082 TAGTTTTTGCTGAAACTGGATGG + Intergenic
1190527392 X:51341836-51341858 CATAATTAGCTGGAAATGGAAGG + Intergenic
1196666515 X:118322886-118322908 CATTATTGGAGGAAAATGGCAGG - Intergenic
1197464927 X:126792087-126792109 CTTCATTGGCAGAAACTGTAGGG - Intergenic
1199945936 X:152667566-152667588 AATCCTTGGCTGAAATTGGATGG + Intergenic