ID: 901378829

View in Genome Browser
Species Human (GRCh38)
Location 1:8859269-8859291
Sequence CTGGAGTTCCAGCCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901378822_901378829 6 Left 901378822 1:8859240-8859262 CCTGTGAAATGACAGCTTCACCC 0: 1
1: 0
2: 1
3: 12
4: 122
Right 901378829 1:8859269-8859291 CTGGAGTTCCAGCCTGCTGCTGG 0: 1
1: 0
2: 2
3: 40
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901378829 Original CRISPR CTGGAGTTCCAGCCTGCTGC TGG Intergenic
900817351 1:4858715-4858737 CTGGATGTCCAGTTTGCTGCAGG + Intergenic
901378829 1:8859269-8859291 CTGGAGTTCCAGCCTGCTGCTGG + Intergenic
901810919 1:11766404-11766426 CTGGAGGTCCAGGCTGGTGGGGG + Exonic
901962339 1:12837528-12837550 CTGAAGTTCTAGACTGATGCAGG - Intergenic
902384938 1:16071192-16071214 CTGGAGCTGCAGGCTGCTGTGGG - Intronic
905380390 1:37557623-37557645 CTGAAGGTCCAGGCTGCTGGGGG - Exonic
905526095 1:38641149-38641171 CTGGTGCTCCAGCTTGCTGATGG + Intergenic
906165041 1:43679874-43679896 CTTGAGTTCCAGCTTTCTTCAGG + Intronic
906210127 1:44008240-44008262 CTGCAGGTTCAGCCCGCTGCTGG - Intronic
906325546 1:44843259-44843281 CTGGAGCTCCAGCCGCCTCCCGG - Intergenic
907425269 1:54375536-54375558 CTGGAGTCACAGTCAGCTGCTGG - Intronic
908444917 1:64191218-64191240 CTGGAGTTCCAGGCTGGACCTGG + Intergenic
910638627 1:89437185-89437207 CTGGAGCTCATGCCTGCTCCTGG - Intergenic
910704341 1:90111255-90111277 CAGGAGTTCAAGGCTGCAGCAGG - Intergenic
914338309 1:146737197-146737219 CTAGAGTTCCAGCCAGATGAGGG + Intergenic
915472694 1:156135358-156135380 CTGGGCTTCCAGCCTGCATCCGG - Intronic
915732656 1:158065248-158065270 CTGGGCTTCCAGCCTGTTGCGGG + Intronic
918035361 1:180866136-180866158 CTGGAGTTCAAGACTGCAGTGGG + Intronic
920228023 1:204451952-204451974 CTGTAGTTGCAGCCTGGGGCAGG - Intronic
920275170 1:204799187-204799209 CCGCAGCTCCACCCTGCTGCAGG + Intergenic
921601610 1:217112107-217112129 CTGCAGTTCCAGGCAGGTGCAGG - Intronic
923412548 1:233724737-233724759 CTGGAGTTTCTTCCTACTGCTGG - Intergenic
924464802 1:244290362-244290384 CTGGAATTCCAGAGTGCTGGGGG - Intergenic
1064216736 10:13406765-13406787 CAGGAGTTCCAGGCTGCAGTGGG - Intergenic
1067565281 10:47331701-47331723 CTGGAGGCCAGGCCTGCTGCAGG - Intergenic
1069242648 10:66162506-66162528 CTGCAGTACCAGCCTGTAGCCGG - Intronic
1069718626 10:70536225-70536247 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
1069932100 10:71889762-71889784 CTGTAGTTCCAGCTACCTGCAGG + Intergenic
1070109156 10:73465486-73465508 CAGGAGTTCAAGGCTGCTGTGGG + Intronic
1071286709 10:84155395-84155417 CTGGATTTCCCACTTGCTGCGGG + Intergenic
1072370670 10:94763911-94763933 CTGGAGTTTCTTCCTTCTGCTGG + Intronic
1072446138 10:95500257-95500279 CTGGGGCTCCAGCCTGATGGAGG + Intronic
1073931213 10:108578987-108579009 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1075312588 10:121427169-121427191 CTTGATTTCCAGCCTGGTTCTGG + Intergenic
1075448276 10:122529089-122529111 CGGGAGTTCCAGAGTGCTGAGGG + Intergenic
1075667992 10:124244472-124244494 CTGGAGCTCCGGCCTTCTGCAGG + Intergenic
1075710446 10:124527852-124527874 CAGGAGTTCCAGGCTGCAGTGGG - Intronic
1076190628 10:128480861-128480883 CTGGAGTGCCTGCGTGCTGGGGG - Intergenic
1076356032 10:129854354-129854376 CTGGAGTTTCAGGCGGCTGATGG + Intronic
1076817441 10:132921810-132921832 CTTGACTTCCAGCCTGGGGCTGG + Intronic
1077504502 11:2923839-2923861 CTGGGTTTCCAAGCTGCTGCTGG - Intronic
1078927374 11:15886834-15886856 CTGGACCACCAGCCTGATGCAGG - Intergenic
1080610771 11:33901802-33901824 CAGGATTTATAGCCTGCTGCTGG + Intergenic
1082708380 11:56521406-56521428 CTGGTTTTCCAGCCTGCAGGCGG - Intergenic
1082865847 11:57899512-57899534 CTGGACTGCCAGCTTGGTGCAGG + Intergenic
1083758787 11:64804854-64804876 CTGGAGTTCCAGCCACTGGCCGG - Intronic
1083851128 11:65367793-65367815 CTGGAGCACCAGCCTGCCACAGG + Intergenic
1084590796 11:70088965-70088987 CTCGAGTGCCTGGCTGCTGCGGG + Intronic
1084729413 11:71063976-71063998 CTGCAGTTCCCACCAGCTGCTGG + Intronic
1085299086 11:75448100-75448122 CTGGTGTTCCAGGCTGTTGTGGG - Intronic
1085726783 11:78961561-78961583 CTGAAGCCCCAGCCAGCTGCAGG - Intronic
1088448169 11:109954522-109954544 CAGCAGTTCCTGCATGCTGCAGG + Intergenic
1088689748 11:112315604-112315626 ATGGGCTTCCAGCCTCCTGCAGG + Intergenic
1088696468 11:112370392-112370414 CTGGGGGTCCAGCCTGAGGCTGG + Intergenic
1089686085 11:120147627-120147649 CTGGACTTACCGCCTGCTGGTGG - Intronic
1090694272 11:129221736-129221758 CAGGAGGTCCAGGCTGCTGTGGG + Intronic
1090802001 11:130178852-130178874 CTGCAGACCCAGCCAGCTGCTGG - Intronic
1091242667 11:134064415-134064437 CTGGAGCACCAGAGTGCTGCAGG + Intergenic
1092111033 12:5965042-5965064 CTGGATTTCCTGGCTGCTGCTGG + Intronic
1092139552 12:6173542-6173564 ATGGTGGTCCAGCCTGATGCTGG - Intergenic
1092405887 12:8221986-8222008 CTGGAGCTCCAGCCTGCTGACGG - Exonic
1092692432 12:11128994-11129016 CAGGAGTTCCAGGCTGCAGTGGG - Intronic
1093570971 12:20665175-20665197 CTAGAGTAAAAGCCTGCTGCTGG + Intronic
1094211980 12:27902564-27902586 CTGGAGTTCTACTCTGCTGCAGG + Intergenic
1094414166 12:30200916-30200938 CTGCAGACCCAGCCTCCTGCGGG - Intergenic
1097844517 12:64352585-64352607 CAGGAGTTCGAGCCTTGTGCAGG + Intronic
1100325579 12:93536860-93536882 CTGGAGTTCCTGTTGGCTGCTGG + Intergenic
1100978571 12:100146472-100146494 CTTGGGTTCCTGCCTTCTGCAGG + Intergenic
1101409722 12:104458050-104458072 CCGGGCTCCCAGCCTGCTGCAGG - Intronic
1101467105 12:104959256-104959278 CAGGAGTTCAAGGCTGCAGCGGG + Intergenic
1101584765 12:106075885-106075907 CTGAAGTTCCAGCTTGATGTTGG - Intronic
1103011303 12:117460493-117460515 CTGGAAATCCGGGCTGCTGCTGG + Exonic
1103460079 12:121096711-121096733 CTGGTTTTAAAGCCTGCTGCTGG + Intergenic
1104811267 12:131621580-131621602 AGGGGGTTCCAGCCTGCAGCGGG + Intergenic
1106906920 13:34419060-34419082 CTGAAGCTACAGCCTCCTGCAGG - Intergenic
1107443863 13:40452580-40452602 CAGAAGTTCTAGCCTGGTGCTGG + Intergenic
1109198887 13:59409415-59409437 CTGGATTTCCTCCCAGCTGCAGG + Intergenic
1110132156 13:72022133-72022155 CTGGAGTTCCATACTGCACCTGG + Intergenic
1110861110 13:80345349-80345371 CTTGAGCTCCAGGCTCCTGCGGG + Intergenic
1111611804 13:90615504-90615526 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1112309582 13:98306586-98306608 CAGGAGTTCGAGGCTGCAGCGGG - Intronic
1113957593 13:114107565-114107587 CCGGAACTCCAGGCTGCTGCGGG + Intronic
1118910408 14:70057541-70057563 ATGGAATTCCAGCCAACTGCAGG - Intronic
1119331835 14:73800655-73800677 CTGGAGTCCTTTCCTGCTGCAGG + Intergenic
1122402592 14:101476157-101476179 CTGCAGTTCCAGCCTCCTGAGGG - Intergenic
1123061369 14:105596204-105596226 CTGGGGCCCCAGCCTGCTCCTGG + Intergenic
1123085823 14:105717115-105717137 CTGGGGCCCCAGCCTGCTCCTGG + Intergenic
1123777929 15:23598963-23598985 CTGGATTTCCAGCTTGCAGAAGG - Intronic
1125325570 15:38533041-38533063 CCGGAGTTGCTGCCTGGTGCTGG - Intronic
1127966128 15:63924193-63924215 CTGGCTTTCCAGTCAGCTGCTGG - Intronic
1128307560 15:66609965-66609987 CTGCATTTCCAGCAAGCTGCAGG + Intronic
1128495476 15:68196027-68196049 ATGGAGACCCAGCCTGCTGTTGG + Intronic
1128511317 15:68315654-68315676 CTGGAGATCGAGCTCGCTGCAGG - Exonic
1129298218 15:74611311-74611333 CTGGAGCTTCAGCCTGCTAAGGG + Intronic
1129441450 15:75583826-75583848 CAGGAGTTCAAGCCTGAGGCTGG - Intergenic
1129456178 15:75677174-75677196 CTGCAGTCCCAGCTGGCTGCAGG - Exonic
1129460384 15:75697401-75697423 CTGTAGCTCAAGCCTGCTGCAGG + Intronic
1129589959 15:76906001-76906023 CAGGACTTCCCGCCTACTGCGGG - Intergenic
1131159813 15:90098317-90098339 CTGGACCTCTAGCCTCCTGCTGG - Intronic
1134355052 16:13474579-13474601 ATGGAGTTACAGCCTGGTGAGGG + Intergenic
1136513938 16:30756586-30756608 CTAGATCTCCAGGCTGCTGCAGG + Exonic
1138445095 16:57058610-57058632 CTGGAGTGACAGCCAGCTCCAGG + Intronic
1138453531 16:57107496-57107518 CTGGAGCGCCAGCCTCTTGCTGG - Intronic
1139139890 16:64248518-64248540 CTGGAGATCCAGCCCTCTGTGGG - Intergenic
1139995971 16:70980156-70980178 CTAGAGTTCCAGCCAGATGAGGG - Intronic
1141656762 16:85420828-85420850 CTGCAGCTCCAGGCTGCGGCCGG - Intergenic
1142105971 16:88302964-88302986 CAGCAGTGCCAGCCTCCTGCAGG + Intergenic
1143060404 17:4195939-4195961 CTGCAGTGCCAGTCTCCTGCAGG - Intronic
1144538581 17:16115391-16115413 GAGGAATTCAAGCCTGCTGCAGG - Intronic
1146650363 17:34602626-34602648 TTGGAGCTGCAGCCTCCTGCAGG - Intronic
1147148154 17:38498130-38498152 GAGGAGTTCCAGTCTGGTGCGGG + Intronic
1148886743 17:50779189-50779211 CAGGAGATCAAGCCTGCAGCAGG - Intergenic
1148929002 17:51112899-51112921 CTGGAGGTCAAGGCTGCTGTGGG + Intronic
1150608579 17:66714761-66714783 CTGGTGTCCCAGACCGCTGCTGG + Intronic
1151194662 17:72423055-72423077 CTGGAGATGGAGCCCGCTGCAGG + Intergenic
1152136644 17:78507761-78507783 CTGGAATTCCATCATGCTCCAGG + Exonic
1152198305 17:78930324-78930346 CCGGAGTTCCAGCCATCGGCAGG - Intergenic
1152307993 17:79532297-79532319 ATGGAGTCCCAGCCTGGAGCTGG - Intergenic
1152530222 17:80914342-80914364 GTGGGGTTCCTGCCTGCTCCCGG - Intronic
1153139506 18:1955047-1955069 CTTGAGTTGCTGCCTGCTCCCGG + Intergenic
1153522737 18:5967730-5967752 ATGGAGCCCCAGGCTGCTGCTGG + Intronic
1156331771 18:36129755-36129777 CAGGGGTTCCAGCCTGCGGTGGG + Intronic
1156355571 18:36337552-36337574 CTGGAGCTCCAGGATGCTGAAGG - Intronic
1156519032 18:37705976-37705998 CTGCAGCTCCAGCATCCTGCTGG - Intergenic
1157668658 18:49510251-49510273 CTGGGGTTCCGTCCTGCTCCAGG - Intergenic
1159009792 18:63047740-63047762 CTGGAGTTCCAGACTTTTGGAGG + Intergenic
1159370107 18:67517630-67517652 CAGGAGTCCCAGCCTGCTCTAGG - Intergenic
1160468568 18:79104815-79104837 CTGGAGGTCAAGGCTGCTGTGGG - Intronic
1160764439 19:801148-801170 CAGGACTTCCAGTCTGCAGCTGG - Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161442902 19:4302495-4302517 CCGGTGTTCCAGCCTGCTGGGGG + Intergenic
1163501974 19:17681569-17681591 CTGGAGTTCCAGAGAGCTTCGGG + Intronic
1164858765 19:31545865-31545887 ATGGAGGTCCAGCATTCTGCAGG + Intergenic
1164906820 19:31974619-31974641 CTCCATCTCCAGCCTGCTGCTGG + Intergenic
1165312590 19:35037883-35037905 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
1165511560 19:36269268-36269290 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165512111 19:36271791-36271813 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165512659 19:36274290-36274312 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165513210 19:36276833-36276855 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165513765 19:36279386-36279408 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165514314 19:36281920-36281942 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165514868 19:36284459-36284481 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165515420 19:36286990-36287012 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165515970 19:36289528-36289550 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165516521 19:36292063-36292085 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165517073 19:36294591-36294613 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165517625 19:36297114-36297136 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165518178 19:36299649-36299671 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165518729 19:36302184-36302206 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165519277 19:36304714-36304736 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165519826 19:36307229-36307251 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1165520379 19:36309760-36309782 CTGGGGTTTCTTCCTGCTGCTGG - Intergenic
1168053087 19:53844701-53844723 CTGTAATTCCAGCCAGCTGGGGG - Intergenic
1168126081 19:54283918-54283940 CTTGGGTTCCAGCCTGCAGGTGG + Intergenic
1168313833 19:55475168-55475190 CCTGAGTTCCAGCCTGCTTGTGG + Intergenic
925253944 2:2466304-2466326 CTGGGCTGCCAGCCTCCTGCAGG - Intergenic
925293563 2:2763755-2763777 CTGGTGTCCCAGCCTGTTCCAGG - Intergenic
925761887 2:7192634-7192656 CAGGAGTTCAAGGCTGCTGCAGG + Intergenic
927904119 2:26845204-26845226 CTGGAGATCCGGCCTTCTGGAGG + Intergenic
929136105 2:38625242-38625264 CTGGAGTCCCTGTCTGCTTCTGG - Intergenic
929144885 2:38697978-38698000 CTGTACTTCCAGCCTGGTGATGG - Intronic
929500725 2:42489314-42489336 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
932301575 2:70671064-70671086 CTGGATTTCCTTCCTGCAGCTGG + Intronic
933090055 2:78107810-78107832 CTGGAGTTCCAGGCTGGACCGGG - Intergenic
933942782 2:87259042-87259064 CTGGACTTCCAGCCTGCAGGTGG + Intergenic
934687454 2:96332258-96332280 CTGACTTTCCAGCCTGCAGCTGG - Intergenic
936004169 2:108867269-108867291 CTGGAGTTCTAGCTTCCAGCGGG - Intronic
936337436 2:111602520-111602542 CTGGACTTCCAGCCTGCAGGTGG - Intergenic
936861960 2:117029638-117029660 TTGGAATTCCAGCCAGCTGCCGG + Intergenic
937267888 2:120628596-120628618 TTGGGGTTCCAGCCTGCTCGTGG + Intergenic
937480846 2:122257404-122257426 ATGTAGTTCCAGCCTACTGAAGG - Intergenic
937973873 2:127569423-127569445 CTGCATTCCGAGCCTGCTGCTGG + Intronic
939932883 2:148255722-148255744 CTGGAGTTCCAGGCTGGACCTGG - Intronic
942023865 2:171894065-171894087 CTGGGGCTCCGGCTTGCTGCGGG - Intronic
943820484 2:192315030-192315052 TTGGAGATCCTGCCTGCTCCCGG + Intergenic
946689850 2:222301744-222301766 CTGGACTCCCATCCAGCTGCGGG - Intronic
948742017 2:240054366-240054388 CTGGAATCCCTGGCTGCTGCAGG + Intergenic
948811583 2:240481114-240481136 CTGGAGTGGCCGCCTGCTGACGG - Intronic
948908540 2:240991569-240991591 CTGGAGACTCAGCCTGCAGCTGG + Intronic
1169160087 20:3370320-3370342 CTGGAGCTCCAGGCTGCAGTGGG - Intronic
1170330344 20:15202777-15202799 CTGGAGTTCCAGCCATCATCAGG + Intronic
1170539251 20:17371327-17371349 CTGGGGTTCCAGTGAGCTGCAGG + Intronic
1170761451 20:19254782-19254804 CTGGAGTTCCAGGTTTCTCCAGG + Intronic
1170772911 20:19349651-19349673 CTGAAGCTCCATCCTGCTGGGGG - Intronic
1171270337 20:23812120-23812142 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1172346925 20:34209415-34209437 GTGGGGTTCCTGCCTGCTCCTGG - Intronic
1173175484 20:40761869-40761891 ATGGAATTCCAGCCTCCTGGGGG + Intergenic
1175404532 20:58717730-58717752 CTGGAGGTGCAGCCTTCAGCCGG - Intronic
1175693456 20:61083184-61083206 CAGAGGGTCCAGCCTGCTGCCGG - Intergenic
1179709572 21:43205523-43205545 CTGGAGTTCCAGGCTCCAGCTGG + Intergenic
1181030716 22:20147825-20147847 CCGGAGTGCCACCCTGCCGCAGG - Exonic
1181673326 22:24436254-24436276 CTGGAGTCACAGCCTGCCTCAGG + Intronic
1183164059 22:36134197-36134219 CTGGAATCCCAGCCTGCTGCTGG - Intergenic
1183175673 22:36223208-36223230 CTGGCATCCCAGCCTGCTGCTGG - Intergenic
1183365573 22:37404961-37404983 CAGGAGTTCCAGCTACCTGCTGG + Intronic
1183690265 22:39384244-39384266 CTCGGGTGCCAGCCAGCTGCTGG + Exonic
1183723383 22:39574994-39575016 CTGGAGAGCCAGCAGGCTGCTGG + Intronic
1184864613 22:47195376-47195398 CTGGAGCCCGAGCCTGCTGGGGG + Intergenic
1185075912 22:48682190-48682212 CTGGCATTCCTGCCAGCTGCTGG - Intronic
949988103 3:9554896-9554918 CAGGAGTTCAAGGCTGCTGTGGG + Intergenic
954273180 3:49525194-49525216 CTGGAGTGACTGCCTGCTTCAGG + Intronic
954389938 3:50263423-50263445 CTGGAGGTCAAGGCTGCTGTGGG + Intergenic
954899631 3:54007691-54007713 CTGGAGCTCCAGCTTCCTGCTGG - Intergenic
956017745 3:64901789-64901811 CTGAGGTTCCAGCCTCCTGGGGG + Intergenic
956101830 3:65776577-65776599 CTGGTTTTCCAGGCAGCTGCAGG + Intronic
958849977 3:99312924-99312946 CTACAGTTCCAGCCTCATGCTGG + Intergenic
959430556 3:106250411-106250433 CAGGAGTTCAAGCCTGCAGTGGG - Intergenic
962453288 3:135539888-135539910 CTGGAAGGCCAGCCTGCTGAGGG - Intergenic
962987857 3:140552124-140552146 CTGATGGTCCAGCCTGCTGTGGG + Intronic
963498968 3:146100894-146100916 CTCTAGTTCCAGGCTGCTGGGGG + Intronic
966379196 3:179326206-179326228 CTGTAATCCCAGCCTCCTGCTGG + Intronic
967114790 3:186327458-186327480 CAGGAGTTCAAGGCTGCTGTGGG - Intronic
969760242 4:9175981-9176003 CTGGAGCTCCAGCCTCCTGGCGG + Exonic
970593411 4:17578249-17578271 CTTGAGCTCCAGTCTCCTGCAGG + Intronic
971200787 4:24507688-24507710 CTGGAGCTCTATCCTGCTGGAGG + Intergenic
971487002 4:27170767-27170789 CTGGTTTTCCAGCCTGCAGATGG - Intergenic
972340795 4:38150825-38150847 CCCGATTTCCAGCCTGCTGCTGG - Intergenic
973337644 4:48972437-48972459 CAGGAGTTCAAGGCTGCAGCGGG + Intergenic
974972068 4:68842774-68842796 CTGGAGTTTCTTCCTGCTGGTGG + Intergenic
977575220 4:98666985-98667007 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
978598358 4:110402526-110402548 CCGGAGTTCCAGGCTGCAGTGGG - Intronic
980306391 4:131065619-131065641 GTGGAGCTCCTGCCTGCTCCTGG + Intergenic
981796472 4:148600801-148600823 CTGGAGCTCCAGGCTGGTACTGG + Intergenic
985299313 4:188471430-188471452 CAGGAGTTCAAGGCTGCAGCGGG - Intergenic
986300600 5:6475798-6475820 CTGGCCCTCCAGCCTGCAGCTGG + Intronic
986338802 5:6773489-6773511 CTGAAGCTCCTGCTTGCTGCCGG - Intergenic
986396156 5:7332952-7332974 CTGGGTTTCCAGCTTGCTGATGG - Intergenic
987418879 5:17694429-17694451 CTGGGGTTCCAGCTTCCTCCAGG + Intergenic
987576234 5:19732376-19732398 CAGGAGTTCAAGGCTGCAGCAGG + Intronic
995727442 5:115196295-115196317 CTGAAGTACCAGCCTGGAGCCGG + Intergenic
996295643 5:121912408-121912430 CTGGAGTTCCAGCCTTCCTTTGG - Intergenic
996749352 5:126873485-126873507 CAGGTGATGCAGCCTGCTGCTGG - Intronic
998252368 5:140561752-140561774 CTGACTTTCCAGCCTCCTGCAGG - Intronic
998363126 5:141608228-141608250 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
1001654548 5:173339619-173339641 CTGGAGAGCCACACTGCTGCAGG - Intergenic
1002177881 5:177412214-177412236 CAGGAGTTCCAGACTGATGTAGG + Intronic
1002465190 5:179404862-179404884 CAGGAGCTCCAGGCTCCTGCTGG - Intergenic
1003193564 6:3895185-3895207 CAGGAGCTCAAGCCTGCTGTGGG + Intergenic
1003359186 6:5408094-5408116 CTGGATTTGCACCCTGTTGCAGG + Intronic
1005335878 6:24795805-24795827 GTGGAGTTGCGGGCTGCTGCAGG + Intergenic
1005905838 6:30260874-30260896 CTGGTGCCCCAGGCTGCTGCAGG - Intergenic
1007503817 6:42318939-42318961 AGGGAGTTCCACCTTGCTGCAGG - Intronic
1008573373 6:52836121-52836143 CTCAAGACCCAGCCTGCTGCTGG + Intronic
1009691028 6:67031908-67031930 CTGGAGTTTCTTCCTTCTGCGGG - Intergenic
1010092236 6:71996767-71996789 TTGGAGATCCATCATGCTGCTGG + Intronic
1010474836 6:76274603-76274625 TTTGAGTGCCAGCTTGCTGCAGG - Intergenic
1010723541 6:79309652-79309674 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1011284164 6:85706111-85706133 CTGCAGCTCCTTCCTGCTGCTGG + Intergenic
1016034581 6:139373517-139373539 CCGGATTTGCACCCTGCTGCAGG - Exonic
1016693462 6:146965557-146965579 TTGGATGTCCAGCCTGCTGCAGG + Intergenic
1017054365 6:150424363-150424385 GTGGGGTTCCTGCCTGCTCCTGG - Intergenic
1018485490 6:164237528-164237550 CCTGAGTTCCAGCATTCTGCAGG + Intergenic
1018565273 6:165144981-165145003 ATGGAGTTCTTGCCTGCTCCTGG + Intergenic
1018938887 6:168294644-168294666 CTGGAGGTGCAGCCTGCAGGCGG + Intronic
1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG + Intergenic
1021456327 7:20832872-20832894 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1023107227 7:36774490-36774512 ATGGGATTCCAGCCTGCTGGTGG - Intergenic
1023166852 7:37351396-37351418 CAGGAGTTCTTGCCTTCTGCTGG + Intronic
1024260873 7:47573080-47573102 CTGGAGATCCAGCCTGCATTGGG - Intronic
1024353735 7:48393916-48393938 CTGGCCTTCCTGCCTGCTGTCGG + Intronic
1024813853 7:53244790-53244812 CAGGAGCTCCAGCCTGCTGAGGG - Intergenic
1026503237 7:70960479-70960501 CTCTAGTTCCAGCTTCCTGCTGG - Intergenic
1026552492 7:71380407-71380429 CAGGAGTTCAAGGCTGCTGGGGG - Intronic
1027257144 7:76438235-76438257 CTGACATTCCATCCTGCTGCTGG - Intronic
1027281707 7:76613807-76613829 CTGACATTCCATCCTGCTGCTGG + Intronic
1027684682 7:81266188-81266210 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1028082726 7:86598896-86598918 TTGGAATTCCAGCCAGCCGCTGG + Intergenic
1028111663 7:86949515-86949537 GTGGAGCTCCTGCCTGCTCCTGG - Intronic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1029701844 7:102252341-102252363 TTGGAATGCCAGCCTGCTGAAGG - Exonic
1030230930 7:107207687-107207709 CTGGAGCACCTGCCTGATGCAGG + Intronic
1030420178 7:109299515-109299537 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1032401246 7:131625953-131625975 CCTGAGTTTCTGCCTGCTGCTGG + Intergenic
1034364504 7:150534589-150534611 TTGGAGTTCCAGCCAGCCACTGG - Intergenic
1035216157 7:157368890-157368912 GTGGAGCTCCTGCCTGCCGCAGG + Intronic
1036263866 8:7259728-7259750 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036265162 8:7267350-7267372 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036266463 8:7274972-7274994 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036267769 8:7282594-7282616 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036269072 8:7290216-7290238 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036270366 8:7297838-7297860 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036296783 8:7543710-7543732 CTGGAGCTCCCGCCTGCCCCTGG - Intergenic
1036301432 8:7572159-7572181 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1036302729 8:7579808-7579830 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1036315906 8:7718267-7718289 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036317213 8:7725915-7725937 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036318521 8:7733563-7733585 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036319830 8:7741210-7741232 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036321137 8:7748858-7748880 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036322446 8:7756506-7756528 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036323754 8:7764154-7764176 CTGGAGCTCCAGCCTCCTGGCGG + Intergenic
1036325784 8:7777309-7777331 CTGGAGCTCCCGCCTGCCCCTGG + Intergenic
1036350988 8:8012506-8012528 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1036352285 8:8020152-8020174 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1036353585 8:8027800-8027822 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1036387548 8:8295355-8295377 CTGATGTCCCCGCCTGCTGCAGG + Intergenic
1036846272 8:12172925-12172947 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1036867635 8:12415244-12415266 CTGGAGCTCCAGCCTCCTGGCGG - Intergenic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1039239946 8:35545472-35545494 CTGGAGAGGCAGCCTGCTGAGGG + Intronic
1040999487 8:53436824-53436846 CTGGAGTTTCTTCCTTCTGCTGG + Intergenic
1041000259 8:53442539-53442561 CTGGAGTTTCTTCCTTCTGCTGG + Intergenic
1042182910 8:66110021-66110043 CAGGAGTTCAAAGCTGCTGCGGG - Intergenic
1043195417 8:77286998-77287020 GTGGAGCTCCTGCCTGCTCCTGG - Intergenic
1043229353 8:77781325-77781347 CAGGAGTTCCAGGCTGCAGTGGG - Intergenic
1043537758 8:81225520-81225542 CTGGTGATCCAGGATGCTGCAGG + Intergenic
1043741017 8:83811460-83811482 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1043826437 8:84934813-84934835 ATGCAGTTACAGCCTGATGCAGG - Intergenic
1045472639 8:102526045-102526067 CTGTAGTCCCAGGCTGCAGCAGG - Intergenic
1045476382 8:102556319-102556341 CTGCAGTTCTAACATGCTGCAGG - Intronic
1046803019 8:118449674-118449696 CTGTAGTCCCAGCCTGCCTCGGG + Intronic
1047898864 8:129397785-129397807 CTGCATGCCCAGCCTGCTGCTGG + Intergenic
1049450383 8:142658179-142658201 CAGAGGTTCCAGCCTGCTTCAGG - Intronic
1050250417 9:3737757-3737779 CTGGAGCTCCTGCCTACTCCAGG + Intergenic
1050295252 9:4197579-4197601 CTGGTGCTCGTGCCTGCTGCTGG + Intronic
1051135180 9:13912102-13912124 CTGGGCCTCCAGCCTGCTGACGG - Intergenic
1053477468 9:38392786-38392808 CCGGAGCCCGAGCCTGCTGCAGG + Exonic
1055000124 9:71439511-71439533 CTTGATTTCCAGCCTGGTTCAGG - Intronic
1056572108 9:87825183-87825205 CTGGGGGTCCTGCCTGCTGTGGG + Intergenic
1060865211 9:126989819-126989841 CTCGAGCTCCAGCCTGATGCAGG - Intronic
1061181244 9:129026454-129026476 CTGGAGTCCGAGGCTGCTCCCGG + Intronic
1061726892 9:132587059-132587081 CTGGAGTTCTCGCCAGCTTCGGG + Intronic
1062681723 9:137785527-137785549 CTGGAATTCCAGGTTGCTGGTGG + Intronic
1185824505 X:3236917-3236939 CTGGGTCTCCAGCCTGCTGATGG - Intergenic
1186593209 X:10953140-10953162 TTGGAATTCCAGCCTGCCACTGG + Intergenic
1187104171 X:16223139-16223161 CTGGAGTTACATGCTGCTGATGG + Intergenic
1189737382 X:44085805-44085827 CTGGGGCTCCAGCTTGCAGCCGG - Intergenic
1190740422 X:53284832-53284854 CTAGAATCCCAGCCTGCTGTTGG + Intronic
1190803584 X:53814257-53814279 TTGGAATTCCAGCCAGCTACTGG - Intergenic
1192272913 X:69600298-69600320 CTGGATTTCCAGCTACCTGCTGG - Intergenic
1192527348 X:71859027-71859049 CTGTAGTTCCAGCCACTTGCGGG - Intergenic
1194594196 X:95837121-95837143 TTGGAATTCCAGCCAGCTACCGG - Intergenic
1198416157 X:136421743-136421765 CTGGAGTTTCATCCTTCTGGTGG - Intergenic
1198680091 X:139172291-139172313 CTGGCCTTACAACCTGCTGCAGG - Intronic
1199615118 X:149649952-149649974 CTGGAGGGGCTGCCTGCTGCTGG - Intergenic
1201235722 Y:11908979-11909001 CTGGGTCTCCAGCCTGCTGCTGG + Intergenic
1201584247 Y:15543490-15543512 CAGGAGTTCCAGGCTGCAGAGGG - Intergenic