ID: 901379326

View in Genome Browser
Species Human (GRCh38)
Location 1:8862520-8862542
Sequence CTGTTTGTGGATGTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901379326_901379332 10 Left 901379326 1:8862520-8862542 CCTGGCTCCACATCCACAAACAG 0: 1
1: 1
2: 2
3: 26
4: 289
Right 901379332 1:8862553-8862575 CGCTGAAACAGATCATATGAAGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901379326 Original CRISPR CTGTTTGTGGATGTGGAGCC AGG (reversed) Intronic
900415660 1:2533328-2533350 ATGTCTGTGTATGTGGAGGCAGG - Intergenic
900566296 1:3333701-3333723 CTGATTTTGGAGGTGGAGCTTGG + Intronic
900998971 1:6137959-6137981 CTGGTTGGGGAGGGGGAGCCAGG + Intronic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
901419637 1:9142356-9142378 CTGGGTGTGAATGTGGGGCCAGG - Intergenic
902243898 1:15106663-15106685 CTCTTGGTGAATGTGGAGCCTGG - Intronic
903182029 1:21609663-21609685 CTGTCTGTTCCTGTGGAGCCTGG + Intronic
903724347 1:25430142-25430164 CAGCCTGTGGACGTGGAGCCCGG + Intronic
905360566 1:37416743-37416765 CTGTTTGTGTATGTGGTCCGTGG - Intergenic
905781749 1:40717024-40717046 CTGGTTGTAGATGTCCAGCCAGG + Intronic
906235801 1:44208436-44208458 CTGTTTGTTGTTGTTGAGACAGG + Intergenic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
911031223 1:93490822-93490844 GTATTTGCTGATGTGGAGCCAGG + Intronic
914725729 1:150325801-150325823 CTGTTTGAGGCTGTGGAGGAAGG + Exonic
917471256 1:175327783-175327805 GTGTTTGTGGAAGAGGAGTCTGG - Intronic
918225449 1:182477229-182477251 CTGATTCTGGATCTGCAGCCAGG - Intronic
919738783 1:200970294-200970316 CTGTCTGGGGATGTGTGGCCTGG - Intronic
919880875 1:201899738-201899760 CTGGTTGTGGAAGCGGAGCTCGG + Exonic
922668938 1:227494591-227494613 GTGCTTGTGGATGTGGAGCCGGG - Intergenic
922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG + Intergenic
924308148 1:242713076-242713098 CAGTTTGTGGATGAGGCGCTTGG - Intergenic
1062764174 10:48680-48702 GTGCTCGTGGATCTGGAGCCGGG - Exonic
1062987570 10:1783477-1783499 CTGTTGGGGGATGGGGAGCTAGG - Intergenic
1063094637 10:2898830-2898852 CTGTTCTTGGAGGTGGAGCCAGG - Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1064440280 10:15347420-15347442 CTGTTTGTGGACTTTGGGCCTGG - Intronic
1066262030 10:33738356-33738378 CTGTTGCAGGATGTGGAGCTGGG - Intergenic
1068200196 10:53774252-53774274 CCATTTTTGGAGGTGGAGCCTGG - Intergenic
1068523744 10:58105399-58105421 CTGGTGTTGGAGGTGGAGCCTGG + Intergenic
1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG + Intergenic
1069537563 10:69266050-69266072 CCTTTTGTGGATGAGGAACCTGG - Intronic
1073092397 10:100953162-100953184 CTGGGTGTGGATGTGGTGGCAGG - Intronic
1073232584 10:101984663-101984685 CTGTTGGTGACTGTGGAGACAGG - Intronic
1074866883 10:117549636-117549658 CCTTTTGTGGGTGAGGAGCCTGG - Intergenic
1077595399 11:3527432-3527454 CTGTTTGTGGATGCCAAGCAGGG + Intergenic
1078145254 11:8718069-8718091 CTGCTTCTGGACTTGGAGCCAGG - Intronic
1078514263 11:12009098-12009120 CTCTTGGTGGATGTGGGGCGGGG - Intronic
1079438213 11:20479825-20479847 CTGTGTGTGTATCTGGATCCAGG - Intronic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1082687354 11:56257369-56257391 CTGTTGGGGGATGGGGTGCCAGG + Intergenic
1083727922 11:64637956-64637978 CTGTGTGTGGGTGTGGGGCCTGG - Intronic
1084251300 11:67901408-67901430 CTGTTTGTGGATGCCTAGCAGGG + Intergenic
1084503999 11:69553836-69553858 CTGGTTATGGATGTGGAGTGGGG + Intergenic
1084821544 11:71694627-71694649 CTGTTTGTGGATGCCTAGCAGGG - Intergenic
1085161744 11:74354051-74354073 TTGTCTGTGGATGTGATGCCTGG + Intronic
1085729914 11:78988616-78988638 CTGTTTCTCAATGTGTAGCCTGG + Intronic
1087439587 11:98165210-98165232 TAGTTTGTGGAAGTGGAGTCTGG + Intergenic
1089479638 11:118793563-118793585 TTATTTGTGGATGTGAACCCGGG - Intergenic
1091027861 11:132158182-132158204 GTGTGTGTGGAGGTGAAGCCAGG - Intronic
1091203162 11:133798127-133798149 TTGTTAGTGGTTGTGGAGCTTGG + Intergenic
1092421558 12:8336206-8336228 CTGTTTGTGGATGCCTAGCAGGG + Intergenic
1093207736 12:16270645-16270667 CACTTTGTGGATGAGGAACCTGG + Intronic
1094813992 12:34166378-34166400 GTGTTCATGGATCTGGAGCCAGG - Intergenic
1095542293 12:43324629-43324651 CTGATGGTGGAAGTGGGGCCTGG + Intergenic
1095813917 12:46400716-46400738 CTGAAGGAGGATGTGGAGCCAGG + Intergenic
1095969372 12:47891227-47891249 CTGTTTGTAGATAAGGAGACAGG - Intronic
1096454337 12:51772683-51772705 CTGTTGATGAAAGTGGAGCCGGG + Intronic
1096906558 12:54941988-54942010 CAGTTTGTGGCTGGGGAGGCTGG + Intergenic
1098439318 12:70501324-70501346 CTGTTGGGGGATGGGGAGCAAGG - Intergenic
1099225993 12:79969838-79969860 ATGTTTGTGGAAGTTGAGACTGG + Intergenic
1099882001 12:88478218-88478240 CTGTCTGGGGATGGGGGGCCAGG + Intergenic
1100433500 12:94551373-94551395 CTGTGTGAGGATGTGATGCCTGG + Intergenic
1103920557 12:124397077-124397099 CTGTTTGTGGGCAAGGAGCCAGG - Intronic
1103974462 12:124693307-124693329 TTGTTATTGGCTGTGGAGCCTGG - Intergenic
1104926282 12:132315696-132315718 CTGAGTGTGGATGCGCAGCCTGG - Intronic
1105214598 13:18276983-18277005 CTGTTTGTGGCTGTGGATTGGGG - Intergenic
1105503889 13:20993621-20993643 CTGTTTGTTAAAGTGGCGCCTGG + Intronic
1107290479 13:38847233-38847255 CTTTTTGGAGATGTGGATCCCGG - Intronic
1108354244 13:49615906-49615928 CTGGTCGTGGCTGTGGGGCCTGG + Intergenic
1111002616 13:82205375-82205397 CTGCTTGAGCATGTGCAGCCTGG - Intergenic
1111443052 13:88305269-88305291 CTGGTGTTGGATGTGGGGCCTGG + Intergenic
1112166391 13:96924704-96924726 CTGTTTGGGGATGGGGGGCTAGG + Intergenic
1113554828 13:111224415-111224437 CTGTGTGTGCATGTGGACTCAGG + Intronic
1114884143 14:26826667-26826689 CAGTTAGTAAATGTGGAGCCAGG + Intergenic
1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG + Intergenic
1115739498 14:36373140-36373162 CTAGTGTTGGATGTGGAGCCTGG + Intergenic
1115928291 14:38462214-38462236 CTGTTGGGGGATGGGGAGTCGGG - Intergenic
1116919507 14:50558191-50558213 CTGTTTTTGTATGTAGAGACGGG - Intronic
1119105091 14:71916172-71916194 TGGTTTGTAGATGTGGAGCTGGG + Intergenic
1119225451 14:72941495-72941517 GTGTATGTGGATGGGGAGCGTGG + Intronic
1122295575 14:100703895-100703917 CAGTTTATGGATGAGGAGTCTGG + Intergenic
1125280144 15:38034563-38034585 GTGGTTGGGGAGGTGGAGCCAGG - Intergenic
1126293367 15:47108599-47108621 CTGTCAGGGGATGTGGAGCAAGG - Intergenic
1126905734 15:53362708-53362730 CTGTGTGTGGATGTGGGGGCGGG - Intergenic
1127499573 15:59543740-59543762 CTGTCAGTGGCTGTGGAGCTGGG + Intergenic
1127839572 15:62819424-62819446 CTCTTGCTGGATGTGGAGTCAGG - Intronic
1128004140 15:64222270-64222292 CTGTTGGTGGATGGGGGGTCGGG + Intronic
1128748360 15:70130813-70130835 GGGTGTGTGCATGTGGAGCCAGG - Intergenic
1130508829 15:84571206-84571228 CAGTTGGTGGTTGTGCAGCCTGG - Intergenic
1130933246 15:88447821-88447843 TTGTTTGTGGGTGTGATGCCTGG - Intergenic
1131107780 15:89746496-89746518 CTGTGTGTGTGTGTGGAGGCGGG - Intergenic
1131614104 15:93995646-93995668 CTGTGTGTGTATGAGGAGACGGG - Intergenic
1132839217 16:1970557-1970579 GTGTGTGTGTATGTGGAGACAGG + Intergenic
1134217071 16:12324449-12324471 TTGTTTGTGGAGATGGAGTCAGG + Intronic
1135845370 16:25913773-25913795 GTGTATGTGGATGTGGAGGGAGG + Intronic
1135845384 16:25913834-25913856 ATGTATGTGGATGTGGAGGGAGG + Intronic
1136252020 16:29011616-29011638 CTGGACCTGGATGTGGAGCCTGG - Intergenic
1139388040 16:66586939-66586961 GTGTTTGTTGATGGGGACCCTGG + Intronic
1139431310 16:66912393-66912415 CTCCCTGAGGATGTGGAGCCCGG - Exonic
1139438280 16:66949248-66949270 CTGCTTTAGGATTTGGAGCCTGG - Intergenic
1139595405 16:67954881-67954903 CTGTTTGTGGATGAGTAGAGGGG + Intronic
1140036660 16:71376456-71376478 GTGTATGTGGATGTGATGCCTGG - Intronic
1140846619 16:78894957-78894979 CTAGTTGTGGAGGTGGATCCTGG - Intronic
1141868740 16:86769788-86769810 CTGCTTGTGGCTGTGGCTCCTGG - Intergenic
1141927595 16:87179338-87179360 CTGTTTGTGGGGGTGGGGCAGGG - Intronic
1142260524 16:89040636-89040658 TGGTGTGTGGATGTGGAGCCGGG - Intergenic
1142440479 16:90094552-90094574 GTGCTCGTGGATCTGGAGCCGGG + Intergenic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1147533769 17:41304245-41304267 CTGGTTGGTGATGCGGAGCCAGG - Intergenic
1149112123 17:53046541-53046563 CTGTGTGTGTGTGTGGAGCAGGG + Intergenic
1149901161 17:60480746-60480768 CTGTTTGAGGATGCTGAGCAAGG + Intronic
1150661267 17:67081786-67081808 CTGTATGTGTATGTGGGGCGGGG + Intronic
1151180130 17:72321288-72321310 CTGTTGTTGGAGGTGGGGCCTGG - Intergenic
1151774897 17:76193900-76193922 CTGTCTGTGGATGTGGAGGTGGG - Intronic
1152184254 17:78844239-78844261 CTGTTTGGGGAGGTGCACCCTGG + Intergenic
1152839699 17:82559229-82559251 CTGTATGTGGATGTGGAGTGCGG + Intronic
1152957085 18:49005-49027 GTGCTCGTGGATCTGGAGCCGGG - Exonic
1154210755 18:12377049-12377071 CTGTTTGCGGCTGTGGGGCCGGG - Exonic
1157351980 18:46896406-46896428 ATGTTTTTGGATGTGGAGGGAGG - Intronic
1158206681 18:55000752-55000774 CTACTTGTGGATGGGGAGCATGG - Intergenic
1160307744 18:77756197-77756219 CTGTTTGGGGTTGTCGAGGCTGG - Intergenic
1160919622 19:1513489-1513511 CTGCTCGTGGATGGGGACCCTGG + Intronic
1161336640 19:3717750-3717772 ATTTTTGTGGATGTGGAGATGGG + Intronic
1161960549 19:7520680-7520702 CTGGGGGTGGATCTGGAGCCGGG - Exonic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1163401280 19:17094492-17094514 CTGCTTGGGGATGTGGAGTGGGG - Intronic
1163455050 19:17401644-17401666 CTGTTTGTGGTAATGGAGCCAGG - Intergenic
1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG + Intergenic
1167507665 19:49879439-49879461 CTGTGTTTGGCTGTGGAGCAAGG - Intronic
928933573 2:36650158-36650180 CTTTCTGGGGTTGTGGAGCCAGG + Intergenic
930292564 2:49513586-49513608 CTATTTGTGGAAGTGTAGACAGG + Intergenic
931091402 2:58890572-58890594 CTGTTGGTGGATGGGGGGCAAGG - Intergenic
931234614 2:60402699-60402721 ATGTGTGTGTATGTGGAGCAGGG - Intergenic
931744130 2:65277087-65277109 CAATTTCTGGAAGTGGAGCCAGG - Intergenic
931942360 2:67266604-67266626 CTCCTTGTGGATTTGAAGCCTGG - Intergenic
934299723 2:91769756-91769778 CTGTTTGTGGCTGTGGATTGGGG + Intergenic
936464751 2:112737326-112737348 CTGTTTGTGGGCGTGTAGACTGG - Exonic
937085867 2:119171284-119171306 CTGTTTGGGGGTGGGGAGCGAGG - Intergenic
937380046 2:121368205-121368227 CTGTCTGTGGATGTGGGCCAGGG - Intronic
938060298 2:128249122-128249144 CTGTTTGGGGATGTGGATAATGG + Intronic
938108743 2:128550527-128550549 CTCTTAGTGGATGTGGGGCCTGG + Intergenic
938776433 2:134545308-134545330 GAGTTTGAGGATGTGGAGACTGG - Intronic
938950918 2:136253839-136253861 CTGTTTGGGGAAGTGAGGCCTGG - Intergenic
938980204 2:136519203-136519225 GTGTTCGTGGATGAGGAGCCTGG + Intergenic
939242036 2:139573429-139573451 CTGATGTTGGAGGTGGAGCCTGG + Intergenic
941076945 2:161016282-161016304 CTGTTGGGGGATGAGGAGCTAGG + Intergenic
945659477 2:212667990-212668012 CTCTTTGTGGATCTGGAACATGG - Intergenic
945759166 2:213891626-213891648 CTGTTAGGGGAAGTGAAGCCAGG - Intronic
947417250 2:229909372-229909394 TTTTTTGTGTGTGTGGAGCCAGG - Intronic
947508512 2:230728906-230728928 CTGTATGTGCATCTGGGGCCGGG - Intronic
948612154 2:239176598-239176620 CTCTGTGTGTGTGTGGAGCCTGG - Intronic
948836807 2:240629821-240629843 GTGTTTGTGGGTGTGGGGTCGGG + Intronic
948919219 2:241053467-241053489 CTGTCTGTGAATGTGGACCTTGG + Intronic
1169469553 20:5871985-5872007 CTGTCTGTGGCTGTGGAGTAGGG - Intergenic
1170664799 20:18377546-18377568 CTGTTAGTGGATGTGCTGGCCGG - Intergenic
1171349350 20:24490882-24490904 GTGTGAGTGGAGGTGGAGCCAGG + Intronic
1171385531 20:24767256-24767278 CTGTTTGGGGTTCTGCAGCCTGG - Intergenic
1172194108 20:33080316-33080338 AGGTTGGTGGATGTGTAGCCGGG + Intronic
1173274894 20:41571874-41571896 CTGTTTCTGGATGGGGATGCTGG - Intronic
1173966032 20:47113570-47113592 CCGAGTGTGGATGTGGAGGCTGG - Intronic
1174776170 20:53345189-53345211 GTTTTTGTGGATATGGAGCAGGG + Intronic
1176297418 21:5081474-5081496 CTGTCACTGAATGTGGAGCCGGG + Intergenic
1177147750 21:17425011-17425033 CTGATGTTGGAGGTGGAGCCTGG + Intergenic
1177515859 21:22150047-22150069 CTGTTGGTGGGTGTGGGGCTAGG + Intergenic
1177732624 21:25047959-25047981 CTAATTTTGGATTTGGAGCCAGG - Intergenic
1179679990 21:43012708-43012730 CTATTTGTGGATGTAGAAACAGG + Intronic
1179859611 21:44180474-44180496 CTGTCACTGAATGTGGAGCCGGG - Intergenic
1179954992 21:44733573-44733595 CTGTTTGTTGATGAGATGCCTGG - Intergenic
1181556271 22:23673437-23673459 CTGTTTGTGGCTGTGGATTGGGG - Intergenic
1181576908 22:23801017-23801039 CTGTTGATGGTTGTGGAGCATGG - Exonic
1181698078 22:24603852-24603874 CTGTTTGTGGCTGTGGATTGGGG + Intronic
1182015557 22:27036590-27036612 CTTTCTGTGGCTGTGGAGCTGGG + Intergenic
1182149919 22:28020696-28020718 CTGAGTGTGGATGGGAAGCCAGG - Intronic
1182957716 22:34442836-34442858 CTGTTAGTGGATCTGGTGTCTGG - Intergenic
1184289051 22:43488436-43488458 CTGTTTGCGGCTGAGGAACCTGG + Intronic
1185276030 22:49950519-49950541 GTGTTTGGGGCTGTGGTGCCTGG + Intergenic
949113579 3:292897-292919 CTGATTTTGGAGGTGGTGCCTGG - Intronic
949597226 3:5560855-5560877 CTGTTTCTTGATCTGGAGTCTGG - Intergenic
949750963 3:7352439-7352461 ATGTATGTGCATCTGGAGCCTGG - Intronic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
950796785 3:15516639-15516661 GTGTTTGGGGGTGGGGAGCCAGG - Intronic
952206822 3:31188585-31188607 CAGTGTGTGGTTTTGGAGCCTGG + Intergenic
952817860 3:37461183-37461205 CTGGTTGTTGCTGTGGAACCAGG - Intronic
955146150 3:56322244-56322266 CTGTTTGTGGATTTGCAGGTAGG - Intronic
956019762 3:64921680-64921702 CTTTTTGTGGATGGGGAGGACGG + Intergenic
957914283 3:86666842-86666864 CTGATTTTGGAGGTGGGGCCTGG + Intergenic
959981216 3:112519773-112519795 CATTTTGTAGATGTGGAACCTGG + Intergenic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
961287766 3:125820264-125820286 CTGTTTGTGGATGCCTAGCAGGG - Intergenic
961452464 3:127008600-127008622 CTGGCTGTGGGTGTGGAGCCGGG + Intronic
961899304 3:130195729-130195751 CTGTTTGTGGATGCCTAGCAGGG + Intergenic
962814714 3:138987768-138987790 CTGGTTCTGGAAGTGGTGCCAGG - Intergenic
964981264 3:162684198-162684220 CACTTTGTGGAGGTGGAGCAAGG + Intergenic
965223065 3:165952671-165952693 CTGTATGTAAATGTTGAGCCTGG - Intergenic
965251858 3:166352560-166352582 GTGTTTGTGCCTCTGGAGCCAGG + Intergenic
965948624 3:174275435-174275457 CTGTTTTTGGATCTGGTGCTGGG + Exonic
966125960 3:176576937-176576959 CTGTTTATGGGTATGGAGACTGG - Intergenic
966383144 3:179363663-179363685 TTTTTTGTGTATGTGGAGTCAGG + Intronic
967669576 3:192217088-192217110 CTGGGTGGGGATGTGAAGCCAGG - Intronic
969010142 4:4055246-4055268 CTGTTTGTGGATGCCAAGCAGGG + Intergenic
969421011 4:7095823-7095845 CTGTTTGTGTCTGTGGGGCTGGG + Intergenic
970275237 4:14392559-14392581 CTGTTTATAGATGGGGAGACAGG + Intergenic
970863930 4:20737619-20737641 CTGTTTGAGAGTGAGGAGCCTGG + Intronic
971136352 4:23872614-23872636 CTGTTTGAGGAAGTAGAGCAGGG - Intronic
971199662 4:24500494-24500516 CTGTTTCTGGCTCTGGAGCCAGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977413802 4:96703404-96703426 CTGATTGTGGAAGTGTACCCAGG + Intergenic
977638219 4:99325132-99325154 CTGGCTGTGGCTGTGGAGCCTGG + Intergenic
977732452 4:100370301-100370323 CTCTTTGTGGATATAGAGACTGG + Intergenic
978651104 4:111006233-111006255 CTGTTGGTTTATGTGGACCCTGG + Intergenic
980822472 4:138035830-138035852 GTGTTTGTGGAAGTGAAACCAGG + Intergenic
980989394 4:139726036-139726058 CTGTTTCTTGATGTGGGGGCTGG - Intronic
982010229 4:151099071-151099093 CTGCTTGTTGATGTGGATGCTGG - Intergenic
983285238 4:165731086-165731108 CTGTTGGTGGATGGGGGGCCAGG + Intergenic
985262883 4:188131363-188131385 CTGTGTGTGTATTTGGAGACAGG + Intergenic
985441353 4:189984320-189984342 GTGCTCGTGGATCTGGAGCCGGG - Intergenic
985802198 5:2011960-2011982 CTTTGTGTGGCTGTGGAGCACGG + Intergenic
986205151 5:5617186-5617208 CTGTCTCTGGAGGTGGAGGCAGG - Intergenic
988443479 5:31258481-31258503 CTGTTTGTGGGTGAGGGGCTAGG + Intronic
989246511 5:39261170-39261192 CTGTTGGGGGATGGGGAGCGAGG + Intronic
991037774 5:62145095-62145117 CTGCTTGTGTATCTGGAGTCAGG + Intergenic
992408266 5:76480093-76480115 CTGTTTGTGTAGGTGGGGGCTGG + Intronic
994544445 5:101146137-101146159 CTGGTTGAGGATGTGGTGCAGGG - Intergenic
997336951 5:133115179-133115201 CTGCTTGTGGCTCTGGGGCCTGG + Intergenic
999389658 5:151180863-151180885 CTAATTGTGGATGTGGGGCCTGG - Intergenic
1002610339 5:180413640-180413662 CTGTGTCTGCCTGTGGAGCCAGG - Intergenic
1002680737 5:180961518-180961540 CTGTTTGTGGTGGTGGACCCAGG + Intergenic
1003673294 6:8179923-8179945 CTGTTTTTGTATTTGCAGCCTGG + Intergenic
1003962356 6:11220534-11220556 CTGTGTGTGGTTGTAGATCCAGG + Intronic
1004248013 6:13998785-13998807 CTGATGTTGGAGGTGGAGCCTGG - Intergenic
1005675248 6:28148071-28148093 CTGTTTGGGGATGTGGAACATGG - Intronic
1006435083 6:34021827-34021849 CCCTCAGTGGATGTGGAGCCCGG + Intronic
1007400463 6:41599786-41599808 CTGGATGTGGGTGTGGAGCCGGG - Exonic
1007730995 6:43946389-43946411 GTGAATGTGGATGTGGAGCTGGG - Intergenic
1009886262 6:69627618-69627640 CTCTTTTAGGATGTAGAGCCAGG - Intergenic
1010100999 6:72108258-72108280 GTGTGTGTGTATGTGGAGACTGG + Intronic
1010960012 6:82135186-82135208 TGATTTGTGGATGTGAAGCCTGG - Intergenic
1011060208 6:83257036-83257058 CTGTTTGGGGGTGTGGGGCTAGG + Intronic
1012870588 6:104668635-104668657 CTGTTTTTGTATGTGGACCATGG - Intergenic
1014234439 6:118938905-118938927 CTGTCAGGGGATGTGGAGCTAGG - Intergenic
1015073200 6:129122835-129122857 CTTTTTGTGGATGAGGAAACAGG - Intronic
1016120742 6:140339064-140339086 CTGTTGGGGGATGGGGAGCTAGG - Intergenic
1018428429 6:163703926-163703948 CTGGTGGTGGAGGTGGAGCAAGG - Intergenic
1018907153 6:168082266-168082288 CAGTCTGTGGATGAGGAGTCTGG + Intergenic
1019339441 7:501872-501894 TTGTGTGTGGATGTGCAGCTGGG + Intronic
1019408211 7:895023-895045 CTGTTGGTGGGTGTGGAGGGTGG + Intronic
1021243816 7:18237144-18237166 CTGTTGTTGGTTGGGGAGCCAGG + Intronic
1021931940 7:25589810-25589832 CTGTTTGGGGGTGTGGAGGAAGG - Intergenic
1022683132 7:32568816-32568838 CTGATTCTGAATGAGGAGCCTGG + Intronic
1023200467 7:37692143-37692165 CTGTTGGGGGATGGGGAGCTAGG - Intronic
1023845296 7:44116926-44116948 CTGCTGGTGGATGTGGTGACGGG - Exonic
1023923221 7:44645948-44645970 GAGTTTGGGGATGTGGAGGCAGG + Intronic
1024436057 7:49356054-49356076 CTATTTCTGGATCTGTAGCCAGG + Intergenic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1026999236 7:74640505-74640527 CTTTTTGTGTGTGTGGAGACAGG + Intergenic
1027189790 7:75989876-75989898 CAGTTGGTGGGTGTGGAGGCTGG - Intronic
1027438358 7:78191576-78191598 TTGTTGATTGATGTGGAGCCTGG + Intronic
1027856756 7:83521599-83521621 TTGTTTGCAGTTGTGGAGCCTGG + Intronic
1027997264 7:85439977-85439999 CTGTTTGGGGGTGTGGGGCAAGG + Intergenic
1028278321 7:88887828-88887850 CTGTGTGTGTTTGTGGAGACTGG - Intronic
1029069250 7:97881808-97881830 CTGTTTGTGGATGCCTAGCAGGG + Intergenic
1029667360 7:102004349-102004371 CTGGTGGTGGAATTGGAGCCTGG + Intronic
1030064850 7:105651784-105651806 ATGTTTGTGCATGAGGAGGCTGG - Intronic
1030096510 7:105905394-105905416 CTGTGTGTGCACATGGAGCCTGG - Intronic
1030847557 7:114439743-114439765 GTGTGTGTGTATGTGGAGACAGG + Intronic
1035544429 8:468613-468635 CTGCTTGTTGATGTGGACCCTGG - Intronic
1036127440 8:6075859-6075881 CTGCTTGTGGATGTCGGGCCTGG - Intergenic
1038529464 8:28306162-28306184 ATGTTTGTGTGTGTGGAGCGGGG - Intergenic
1039141692 8:34397065-34397087 CTATCTGTGGATGAGGAACCTGG - Intergenic
1039237812 8:35522070-35522092 ATGTTTGTTGATGGGGAGCATGG - Intronic
1039764339 8:40612437-40612459 CTGTGTGTGCATGGGAAGCCAGG - Intronic
1040525025 8:48214589-48214611 TTGTTTGTTGTTGTGGGGCCAGG - Intergenic
1041348927 8:56929541-56929563 CTGTCTGTGGCTGTGGAGCTGGG + Intergenic
1043560524 8:81488319-81488341 TTCTTTGGGGATGTGGAGACTGG + Intergenic
1044136418 8:88591707-88591729 CTGTGTGTAGATGTGTAGGCTGG + Intergenic
1044250283 8:89998077-89998099 CTGGTGTTGGAGGTGGAGCCTGG + Intronic
1044894665 8:96878696-96878718 GTGTTTGTGCATGTGGAGACTGG + Intronic
1048087269 8:131196967-131196989 CCATTTCTGGATCTGGAGCCAGG + Intergenic
1049491537 8:142905950-142905972 GTGTTAGTGTATGTGGAGACAGG - Intronic
1050656637 9:7835873-7835895 CTGTTTGGGGATGTGGAGAAAGG - Intronic
1050727738 9:8670991-8671013 GTGTGTGTGGATGTGGAGGTGGG + Intronic
1050805420 9:9671011-9671033 CTGTTGGTGGATCTGGAGTATGG - Intronic
1051104764 9:13566792-13566814 CTGTTTCTCGATGTGGATGCTGG + Intergenic
1051269667 9:15343198-15343220 CTGTTGTTGGAAGTGGGGCCTGG - Intergenic
1052221024 9:26022622-26022644 CTGTTTGGGGGTGGGGAGCTAGG - Intergenic
1052329970 9:27257534-27257556 CTGTTGGTGGGTGGGGAGCTAGG + Intergenic
1052967512 9:34351862-34351884 TTGTTTTTGGATGTGGAGACAGG + Intergenic
1057371962 9:94481515-94481537 TTGTTTTTGGTTGTGGATCCTGG - Intergenic
1058447474 9:105066618-105066640 CTGTTTGTGTTTCTGGTGCCAGG - Intergenic
1058888222 9:109339057-109339079 CTGTTTGGGGATGTTCAGCTAGG - Intergenic
1059803015 9:117770128-117770150 CAGCTTGTGAATGTAGAGCCAGG + Intergenic
1060664315 9:125423816-125423838 CTGTTGGGGGAGGTGGACCCAGG + Intergenic
1060787261 9:126460543-126460565 CTGTGTAGAGATGTGGAGCCAGG + Intronic
1061847753 9:133397397-133397419 CTGGTCGTGCATGTGGAGCAAGG - Intronic
1061947426 9:133916526-133916548 CAGTTTGAGGATGTGGGGCTGGG + Intronic
1062584290 9:137241934-137241956 GTGCTCGTGGATCTGGAGCCCGG + Exonic
1062741082 9:138175624-138175646 GTGCTCGTGGATCTGGAGCCGGG + Intergenic
1186471825 X:9827747-9827769 CTGTGTGGGGAGGTGGAGCAAGG + Intronic
1186900547 X:14050764-14050786 CAGTTGGTGGGTGAGGAGCCTGG + Intergenic
1186924601 X:14319320-14319342 CTGTTGGGAGATGTGGAGACTGG + Intergenic
1187735163 X:22295662-22295684 CTTTTTGGGGGTGTGGAGCCTGG - Intergenic
1187826609 X:23337439-23337461 CTTTTGGTAGATATGGAGCCAGG + Intronic
1188175782 X:26987068-26987090 GTGTTTGTGTCTGTGGAGTCTGG - Intergenic
1188312580 X:28635801-28635823 GTGTGTGTGTATGTGTAGCCCGG + Intronic
1189859728 X:45260023-45260045 CTGTTGGTGGCTGTGGTGACAGG + Intergenic
1190376511 X:49793653-49793675 CTGTTTGTGGGTCTGGTTCCAGG + Intergenic
1190376685 X:49795283-49795305 CTGTTTGTGGGTCTGGTTCCAGG + Intergenic
1192013680 X:67303671-67303693 CTGTCTGGGGATGGGGGGCCAGG + Intergenic
1193250039 X:79280211-79280233 CTGTTGGTGGGTGGGGAGCTAGG + Intergenic
1193405006 X:81089871-81089893 CTGTTGGGGGATGTGGGGCAAGG + Intergenic
1193915250 X:87355128-87355150 CAGTATGTGCTTGTGGAGCCAGG + Intergenic
1194870116 X:99119524-99119546 CTGTTTGGGGATGGGGGGCTAGG - Intergenic
1197003801 X:121472181-121472203 CTGTTGGGGGATGTGGGGCTAGG - Intergenic
1197885509 X:131213615-131213637 CTGTGTGTGAGTGTGGAGGCGGG - Intergenic
1199541262 X:148960097-148960119 GAGTGTGTGGATGTGGAGCAGGG + Intronic
1199802340 X:151264089-151264111 CTAGTGTTGGATGTGGAGCCTGG + Intergenic
1199817540 X:151411926-151411948 CTGTTCATGGATGTGGGGGCGGG + Intergenic
1201467392 Y:14298318-14298340 CTGTTTGGGCATGGGGAGCTAGG - Intergenic