ID: 901380019

View in Genome Browser
Species Human (GRCh38)
Location 1:8866852-8866874
Sequence GAAACACTTGTGACTATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901380015_901380019 28 Left 901380015 1:8866801-8866823 CCAGTTCACGCCAGGTCTATTTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 901380019 1:8866852-8866874 GAAACACTTGTGACTATGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 118
901380016_901380019 18 Left 901380016 1:8866811-8866833 CCAGGTCTATTTTGATAACTGCA 0: 1
1: 0
2: 3
3: 15
4: 176
Right 901380019 1:8866852-8866874 GAAACACTTGTGACTATGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901380019 Original CRISPR GAAACACTTGTGACTATGTC AGG Intronic
901380019 1:8866852-8866874 GAAACACTTGTGACTATGTCAGG + Intronic
906275417 1:44511706-44511728 GAACCACTTATAATTATGTCTGG + Intronic
908485124 1:64584164-64584186 GAAAGACATGTGGCAATGTCTGG + Intronic
908710937 1:67013410-67013432 CAGACACTTGTGACCATGACTGG - Intronic
910106139 1:83633112-83633134 GTAACCTTTGTGATTATGTCTGG + Intergenic
911523876 1:98961049-98961071 GAAACACTTCAGACTAGGTTAGG - Intronic
914800599 1:150959515-150959537 GAAACACTTGTGTCCCTCTCTGG - Intronic
915310708 1:155004614-155004636 GACATATGTGTGACTATGTCTGG + Intronic
918315942 1:183322753-183322775 CAAACACTTGAGACTATTTAAGG + Intronic
919236951 1:194858833-194858855 GAAAGAATTCTTACTATGTCGGG + Intergenic
1068823872 10:61411017-61411039 TAAGCACTTGTGACCATGACTGG - Intronic
1070271308 10:74958394-74958416 AAAACATTTGTGATTATGTTGGG + Intronic
1070553572 10:77511052-77511074 CAAACACCTGTGAGTATGTTGGG + Intronic
1071240393 10:83698569-83698591 GAAACCCTTGTTCCTATGACCGG - Intergenic
1076243136 10:128925483-128925505 GAAACACTGGTGACTGTCACTGG - Intergenic
1077669999 11:4148443-4148465 AAAACACTTGGAACCATGTCTGG - Intergenic
1078473612 11:11611670-11611692 GAAAGACACGTGACTATGCCAGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1086772998 11:90792893-90792915 AAAACAGTGGTGTCTATGTCAGG - Intergenic
1092120441 12:6039941-6039963 GAAACACTTAGGCCTCTGTCTGG - Intronic
1094005008 12:25740076-25740098 CAAACAATGGTGACTATGTATGG + Intergenic
1095114359 12:38334126-38334148 GAAATACTTGTGCTTATGTGTGG - Intergenic
1099094742 12:78359776-78359798 CAACCATTTGTGACTCTGTCTGG + Intergenic
1099285684 12:80711629-80711651 AAAACATGTGTGAATATGTCTGG + Intergenic
1101634549 12:106527570-106527592 GAAACACTTGTGACAGTCACAGG + Intronic
1104220140 12:126774780-126774802 GATGACCTTGTGACTATGTCTGG + Intergenic
1104322116 12:127761565-127761587 GAAGCAGTTGTGGCTATTTCAGG - Intergenic
1107048481 13:36020850-36020872 GAAACACTAGAGACTCTTTCAGG + Intronic
1111212309 13:85095282-85095304 GAAGCACTTAGGACAATGTCTGG + Intergenic
1111583802 13:90259096-90259118 TAAACACTTGGAGCTATGTCAGG + Intergenic
1113006125 13:105704315-105704337 TAAACACCTCTGACTATGTTTGG + Intergenic
1114526187 14:23368030-23368052 GATTCACTTGTGACTCTGACTGG - Intergenic
1114703227 14:24699899-24699921 CAAACACATGTGACTATAACTGG - Intergenic
1116333512 14:43626473-43626495 GAAATACAGTTGACTATGTCAGG - Intergenic
1119115418 14:72016319-72016341 CAAACACGTGTGACTGTGTGTGG + Intronic
1125308329 15:38348848-38348870 GAAACACTTGTAAATGTATCAGG + Intronic
1126122663 15:45267633-45267655 GAAACACTGATGCCTAAGTCTGG + Intronic
1126992738 15:54401367-54401389 GAATGACTTGTGACTGTGGCAGG - Intronic
1130694983 15:86122184-86122206 GAACCTCCTGTGACCATGTCGGG - Intergenic
1132045593 15:98560562-98560584 GACACACGTGTGACTAACTCAGG - Intergenic
1133032333 16:3017439-3017461 GAATCACTTCTGACTAGGGCCGG + Intronic
1139093800 16:63680386-63680408 GAAACACCTGTCCCTATGTAGGG + Intergenic
1146240145 17:31214035-31214057 GAAATACTTGTATGTATGTCTGG + Intronic
1147517195 17:41131302-41131324 GAAGCAGCTGTGACCATGTCCGG + Intergenic
1163260496 19:16186794-16186816 GAAGCACATGTGGCAATGTCTGG + Intronic
1164660551 19:29962104-29962126 GGAACCCTTGTGAATTTGTCCGG - Intronic
1166420813 19:42634648-42634670 GAAAGAATTGTGAGTATGTGAGG - Intronic
925887856 2:8408869-8408891 AAACCACTTGTGACCATGTTCGG - Intergenic
928251463 2:29685077-29685099 GAATCAATTGTGACTGTGGCTGG + Intronic
933588382 2:84204422-84204444 GAAACACCTGCCACAATGTCTGG + Intergenic
938158109 2:128958655-128958677 GAAAGATTTGGGGCTATGTCAGG + Intergenic
940567232 2:155382377-155382399 AAAACACTTATTACAATGTCTGG - Intergenic
941017700 2:160375336-160375358 GAATCACTTATGACTAAGTCGGG - Intronic
1169756100 20:9045049-9045071 GATAAACCTGTGACTATTTCAGG - Intergenic
1169857098 20:10114768-10114790 TCATCACTTGTGTCTATGTCAGG - Intergenic
1173097741 20:40053051-40053073 GAAAACCATGTGACCATGTCTGG - Intergenic
1180097282 21:45562354-45562376 GGAACATTTGTGACTGTCTCTGG + Intergenic
949959444 3:9300090-9300112 GAAATACTTGGAACAATGTCTGG + Intronic
953798961 3:46006857-46006879 GAAACACTCTTTACTATCTCAGG - Intergenic
955500046 3:59574543-59574565 AAAACACATGTGACAATGCCTGG + Intergenic
955712497 3:61795052-61795074 GAGACACTTGACACTGTGTCAGG - Intronic
957164769 3:76658202-76658224 GAGATAATAGTGACTATGTCTGG - Intronic
957481403 3:80801538-80801560 GAAACACTTCAGAATCTGTCTGG + Intergenic
959344004 3:105169809-105169831 GAAACATTAGTGATTATTTCTGG - Intergenic
959850821 3:111084506-111084528 GAACCACTTGTGTTTATGTATGG + Intronic
963670869 3:148250570-148250592 GAAACACTTAGGACAATGCCTGG - Intergenic
964259466 3:154818999-154819021 GAAACAGTTGTGTCTTTTTCTGG - Intergenic
965261832 3:166496472-166496494 GAGACACTTGTGAAGATGTTTGG + Intergenic
968213749 3:196870269-196870291 GAAACCCTTGTGACTTTTTTTGG + Intronic
968902607 4:3438600-3438622 GACACAGTTGTGTCTATGCCAGG - Intronic
972359312 4:38313055-38313077 AAAACACTTGTCACCATGCCTGG + Intergenic
972882349 4:43440974-43440996 GAAATAGTTGTCACTCTGTCAGG + Intergenic
974374862 4:61062691-61062713 GAAACATTTGTGACCTTGCCAGG - Intergenic
975005954 4:69286336-69286358 TAAACACTTGTGTTTATTTCAGG - Intronic
975403096 4:73960051-73960073 TAATCAGTTGTGAATATGTCTGG + Intergenic
976835859 4:89372667-89372689 GAAACATTTCTGACTATGGGAGG - Intergenic
978365698 4:107979137-107979159 GGCACACTAGTGACTATGCCAGG + Intergenic
987393990 5:17403776-17403798 GCAACACCTGGGACAATGTCAGG - Intergenic
987889641 5:23860043-23860065 AAAACACTTGAGACTTTTTCAGG - Intergenic
988449381 5:31325239-31325261 GAAATACTTGTTACTATATAGGG - Exonic
991030430 5:62076745-62076767 GAAACACTTGAGAGTTTGTTAGG - Intergenic
992727482 5:79623403-79623425 GGAACACATCTGACTATATCTGG - Exonic
994010298 5:94894600-94894622 GAGACACATGTGACTAGATCAGG - Intronic
994729761 5:103477790-103477812 GAAATACTTGTCTCTATTTCAGG - Intergenic
996544316 5:124661499-124661521 GAAATACTTGTAACTCTGTGGGG - Intronic
1001368957 5:171176812-171176834 GAAACAGATGTGAGGATGTCTGG - Intronic
1003053324 6:2798756-2798778 GAAACACCTGTCACTAGGCCTGG - Intergenic
1004692303 6:18003159-18003181 AAAAAACTTGTGACCATGGCAGG - Intergenic
1007828992 6:44624136-44624158 AAAACACTTAGGACTGTGTCTGG + Intergenic
1011494606 6:87925827-87925849 GAAGCACCTGGCACTATGTCTGG - Intergenic
1011825314 6:91299323-91299345 CAAACACCTGTAACTATCTCAGG - Intergenic
1011999767 6:93638467-93638489 GCAACTCTTGTGACTTTGTGAGG - Intergenic
1013731445 6:113172871-113172893 GAAACAGTTATGGCTCTGTCTGG + Intergenic
1013746408 6:113351594-113351616 GAACCACATGTGACAATGGCAGG + Intergenic
1013981640 6:116137079-116137101 CAAACACTGGTGAATATGTGTGG - Intronic
1015002763 6:128239613-128239635 GAAACCCTTGGGAATATTTCAGG - Intronic
1016324150 6:142880449-142880471 GACACGCTGGTGACTGTGTCTGG - Intronic
1016493406 6:144632334-144632356 GAAACGTTTGTGAATATGGCTGG + Intronic
1017273112 6:152532603-152532625 GAAAATGTTGTGACTATCTCAGG - Intronic
1017896477 6:158684522-158684544 GAACCACATCTGACTATATCAGG + Intronic
1019871576 7:3768738-3768760 GAAGCATTGGTGACTATTTCTGG - Intronic
1020344471 7:7148199-7148221 GAAAAACATGTGACCATCTCAGG - Intergenic
1020617085 7:10472607-10472629 AAAATACTTGTTACAATGTCAGG + Intergenic
1023841101 7:44097991-44098013 GAATCACTTGTTTTTATGTCTGG - Intergenic
1038410960 8:27359623-27359645 GAATCACTTGTCACCATCTCTGG + Intronic
1039372631 8:37002125-37002147 GGGACACTTGTGACTATTTTGGG + Intergenic
1041812045 8:61922431-61922453 GCAACACCTGTGAATATTTCTGG - Intergenic
1050006983 9:1141964-1141986 GAAACACTTGGGATAATGGCAGG - Intergenic
1050926085 9:11264936-11264958 GAAAAAGTTTTGATTATGTCTGG + Intergenic
1055217738 9:73887216-73887238 GATTCAGTTGTGAATATGTCTGG + Intergenic
1061303033 9:129717187-129717209 CAGACACTTGTGACCATGCCTGG + Intronic
1196718675 X:118833537-118833559 GAAACACATATTACAATGTCTGG + Intergenic
1197033996 X:121853322-121853344 GAAACAATAGTAACTATGTGTGG - Intergenic
1197454766 X:126665440-126665462 GGAACACTTGTGACAGTGACAGG - Intergenic
1197929054 X:131677311-131677333 AAAACACTTATGACAATGCCTGG - Intergenic
1199417045 X:147597337-147597359 AAAACTCTTGTGATTATGTTAGG - Intergenic
1199814384 X:151384997-151385019 TAAACACTTGTGGCCAAGTCTGG - Intergenic
1201850724 Y:18477003-18477025 GTAAAACTTGTGAGTATGTTAGG - Intergenic
1201882594 Y:18843374-18843396 GTAAAACTTGTGAGTATGTTAGG + Intergenic
1201931458 Y:19354173-19354195 GAAAAACTTGTGACTATGCGTGG + Intergenic