ID: 901380632

View in Genome Browser
Species Human (GRCh38)
Location 1:8871510-8871532
Sequence AAGAGGCTGATGATCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901380628_901380632 -8 Left 901380628 1:8871495-8871517 CCTTTCTAGCCCGTGAAGAGGCT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 208
901380625_901380632 0 Left 901380625 1:8871487-8871509 CCCTGGATCCTTTCTAGCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 208
901380626_901380632 -1 Left 901380626 1:8871488-8871510 CCTGGATCCTTTCTAGCCCGTGA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 208
901380624_901380632 4 Left 901380624 1:8871483-8871505 CCTTCCCTGGATCCTTTCTAGCC 0: 1
1: 0
2: 1
3: 24
4: 320
Right 901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 208
901380622_901380632 30 Left 901380622 1:8871457-8871479 CCATTCAGGGCAGGTCATTGGTT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901380632 Original CRISPR AAGAGGCTGATGATCTCTGG AGG Intronic
900287059 1:1906866-1906888 GAGTGGCTGAAGCTCTCTGGGGG + Intergenic
900309069 1:2024737-2024759 AAGAGGCTGAGGACCTCCCGGGG + Intronic
900743375 1:4343828-4343850 AAGGGGCTGATGGTCTCTTCTGG + Intergenic
901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG + Intronic
901824457 1:11851626-11851648 AGGAGGTTGGGGATCTCTGGGGG + Intergenic
902653536 1:17852349-17852371 AAGAGCCTCAAGATCTCTTGGGG - Intergenic
903277565 1:22231615-22231637 AAGGGGCTGCATATCTCTGGCGG + Intergenic
903931480 1:26864735-26864757 GGGAGGCTGACGAGCTCTGGTGG + Intergenic
903974187 1:27138448-27138470 AAGAGGCTCCTGATGTCAGGGGG - Intronic
905276191 1:36819670-36819692 AAGAGGCTGAAGACCGCTTGGGG + Intronic
906390511 1:45411371-45411393 AAATGCCTGATGATCTCAGGTGG - Intronic
907298672 1:53471555-53471577 GAGATGCTGAAAATCTCTGGTGG - Intergenic
908041364 1:60117199-60117221 AAGAGGCTGATGATGGCATGTGG + Intergenic
909713440 1:78678464-78678486 AAGAAGCTGAAGCTCTTTGGAGG + Intergenic
913242857 1:116844882-116844904 AGGAGGCTCATCATGTCTGGTGG - Intergenic
913992037 1:143622310-143622332 AAGATGCTGATGAACTGGGGAGG - Intergenic
915498820 1:156300347-156300369 AAGAGGGAGGTGATATCTGGTGG - Intergenic
916486650 1:165265452-165265474 AAGAGGCAGAGGAGCTCTTGTGG + Intronic
919265071 1:195252282-195252304 AACATCCTGATGATCTCAGGTGG + Intergenic
920188261 1:204175909-204175931 AAGAGGGTGACGATAACTGGAGG + Intergenic
921260569 1:213382287-213382309 AAGGGGCTAATGATCCCTGTGGG + Intergenic
921384540 1:214555231-214555253 AAAACTCTGATGATCTCTAGGGG + Intergenic
923241753 1:232092347-232092369 TGGAGGCTGAAGTTCTCTGGAGG - Intergenic
1063186281 10:3654626-3654648 AACATGCAGATGATCTCTGAGGG - Intergenic
1063927914 10:10998602-10998624 AACTTGCTGTTGATCTCTGGGGG + Intergenic
1063965442 10:11342763-11342785 AAGAGGAGGAAGGTCTCTGGGGG - Intergenic
1064678462 10:17785236-17785258 GACACGTTGATGATCTCTGGTGG - Intronic
1064959429 10:20947055-20947077 ATGATGCTGATGATATCTGAAGG + Intronic
1068600598 10:58952624-58952646 AAGAGGCTGATTTTGTCAGGAGG + Intergenic
1072831148 10:98660187-98660209 AAGAGGCAGCTGATCCCTGAGGG + Intronic
1073007160 10:100333296-100333318 ACGAGGGTGAGGACCTCTGGTGG + Intergenic
1073928254 10:108542901-108542923 AAGAGGCTGATGATGTTTTTTGG - Intergenic
1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG + Intergenic
1077606637 11:3616866-3616888 AAGAGGCTGAGGACCGCTGCTGG + Intergenic
1077982600 11:7315671-7315693 ATAAGGCTGATGATCCCTGGTGG + Intronic
1079933006 11:26588176-26588198 AAGAGGCTCAAGAACTCTTGAGG - Intronic
1079992100 11:27256795-27256817 AAGATGCTGATAAACTCTGTAGG - Intergenic
1080432711 11:32213408-32213430 AAGAGGCTGAGGCTCTCGAGGGG + Intergenic
1081511179 11:43774968-43774990 AAGAAGGAGATTATCTCTGGTGG + Intronic
1081668885 11:44932480-44932502 AAGAGGCTGCTGATGGCTGGAGG + Exonic
1081757202 11:45553166-45553188 AAGATGCTTATAATCTATGGAGG - Intergenic
1083146110 11:60760098-60760120 AAGAGGGTGATGATCGAAGGGGG - Intronic
1083670497 11:64297357-64297379 GAGAGGCTTATGGTCTTTGGGGG - Intronic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1085510729 11:77086796-77086818 AAGAGGCTGGTGAGGCCTGGCGG + Intronic
1086402755 11:86474011-86474033 AAGAGACTGCTGGTCACTGGAGG + Intronic
1088075797 11:105847051-105847073 AAGATCCTGATGATCTGAGGTGG - Intronic
1088075816 11:105847167-105847189 AAGATCCTGATGATCTGAGGTGG - Intronic
1088452612 11:109998018-109998040 AAGAGGCTGAGGAGCTGTGAAGG + Intergenic
1089685812 11:120146124-120146146 ATGAGGCTGATGTTCTCTCAGGG - Intronic
1091319600 11:134640263-134640285 AAGAGACAGATCAGCTCTGGGGG + Intergenic
1091529926 12:1344410-1344432 AAGAAGCTGTTGATCTCTGAAGG + Intronic
1091811236 12:3399536-3399558 AAGAGGCTCATGATGTCTCTGGG - Intronic
1092525919 12:9310350-9310372 AAGGGGCAGATGTTGTCTGGAGG - Intergenic
1094031754 12:26020170-26020192 ATGAGGCTGTTGAACTGTGGAGG + Intronic
1094475277 12:30835961-30835983 AAGAGAATGATGATCCTTGGTGG - Intergenic
1098118772 12:67211813-67211835 ATGAGGCAGAGGAACTCTGGAGG + Intergenic
1098220695 12:68266974-68266996 AAGAGGCTGCTGATGTCATGAGG - Intergenic
1101293775 12:103399575-103399597 ATGAGGCTGAGGGTCTCTTGGGG - Intronic
1102789053 12:115629054-115629076 AAGAGGCTTATGAGTTGTGGGGG + Intergenic
1103016356 12:117497677-117497699 AAGTGGCGGATTATCTCAGGTGG - Intronic
1105915853 13:24915180-24915202 AAGATCCTATTGATCTCTGGAGG - Intronic
1111881726 13:93965745-93965767 AAGAGGCTGCTGTCATCTGGTGG - Intronic
1115109710 14:29807130-29807152 AAGAGCCTGATGATCTGAGGTGG - Intronic
1117582968 14:57171498-57171520 AAGAGCCTGTTGATGTCTGCTGG + Intergenic
1118437668 14:65786412-65786434 AAGAGGCTGATGTTCTGTGGAGG + Intergenic
1119471829 14:74905403-74905425 AAGAGGCTCATGGTGCCTGGGGG - Exonic
1119488491 14:75009081-75009103 AAGAGGGTAATGAGCTCTGGGGG - Exonic
1121199381 14:92105063-92105085 AATAGGCTGATGTTCAGTGGGGG - Intronic
1122441820 14:101737249-101737271 AAGGGGCTGATGTGATCTGGGGG - Intergenic
1122992874 14:105246852-105246874 AAGACGCTGACTACCTCTGGCGG + Intronic
1124424275 15:29550082-29550104 ATGAGTCTGATCATGTCTGGAGG - Intronic
1124849987 15:33327203-33327225 CAGAAGCTGATGAGCACTGGAGG + Intronic
1125675071 15:41497542-41497564 AAAAGCGTGATGTTCTCTGGGGG + Intronic
1126959921 15:53980426-53980448 AAGAAGCTTATGATGTCTGTAGG + Intergenic
1127698509 15:61474616-61474638 CAGCGGCTGATGGTCTCAGGAGG + Intergenic
1129338710 15:74871067-74871089 AAGAGGCATAGGAGCTCTGGAGG + Intronic
1133835750 16:9365972-9365994 AGGAGGCTGAGGATCGCTGGGGG + Intergenic
1134789768 16:16978988-16979010 AAGACAGTGATGTTCTCTGGGGG + Intergenic
1135084450 16:19463836-19463858 AAGACGCTGAAGATCATTGGAGG + Exonic
1137445797 16:48531483-48531505 CAGAGGCTGATGTACTCAGGTGG + Intergenic
1138116499 16:54364766-54364788 AAGAAGCTCCTGATCTCTTGAGG - Intergenic
1138500687 16:57441743-57441765 AAGAGGAAGTTGATCCCTGGAGG - Intronic
1139132858 16:64167135-64167157 TAGAAGCTGAGGATCTCTGAAGG + Intergenic
1141691547 16:85599583-85599605 AAGAGGCTTGTGATCACAGGTGG - Intergenic
1142106151 16:88303932-88303954 AAGTTGCTGATGAGGTCTGGGGG + Intergenic
1145940678 17:28741891-28741913 AGGTGGGTGATGATTTCTGGAGG + Intronic
1145957118 17:28862167-28862189 AAGAAGCTCATCATCTCTGCCGG + Intergenic
1146633219 17:34485291-34485313 AGGAGGCAGATGGTCTCTAGGGG - Intergenic
1147481855 17:40772662-40772684 CTGAGGCTGAGGATCACTGGAGG - Intergenic
1147568226 17:41550664-41550686 GAAATGCTGATGATCTCTGATGG - Intergenic
1147979342 17:44265071-44265093 GAGGGGCTGCTGATCACTGGGGG + Intronic
1149136525 17:53372104-53372126 TAGTGCCTGATGATCTGTGGTGG + Intergenic
1150042179 17:61875623-61875645 AAGAGGGGGAAGTTCTCTGGTGG - Intronic
1150455140 17:65301254-65301276 CAGATCCTGATGATCTCTGGGGG - Intergenic
1151819693 17:76490848-76490870 AAGTGGTTGATTCTCTCTGGAGG - Intronic
1152290809 17:79438972-79438994 AAGAAGCTGATGGTTTCGGGAGG - Intronic
1155550110 18:26955705-26955727 AAGAGGCAGGTGATTACTGGTGG + Intronic
1158445560 18:57517660-57517682 AGGAGGTTGATCATCTCTGATGG - Intergenic
1158970007 18:62657415-62657437 AAAAGTCTGGTGATATCTGGGGG + Intergenic
1161273060 19:3400928-3400950 AAGAGGCTGATGGGCTGTGCTGG + Intronic
1162134052 19:8544439-8544461 AAGACGCTCATGATGCCTGGGGG + Exonic
1163323095 19:16586071-16586093 AAGAGGCTGGGGATCTCAGGCGG - Intronic
1163537135 19:17883467-17883489 AAGACACTGATTATCTCTTGGGG - Intronic
1163829927 19:19542678-19542700 AAGGGGCTGAGGATCTGGGGAGG + Intronic
1165395088 19:35559547-35559569 AAGAGGCTGATGTCCTGTGCAGG - Intronic
1165810577 19:38609496-38609518 ATGATGCTGAGGGTCTCTGGAGG + Intronic
1166632262 19:44417383-44417405 AAGAGGCTGAGGATCTCTTGAGG + Intergenic
1167042767 19:47032404-47032426 AAGAGGCTGCTGTTCTCCAGAGG - Intronic
1168147409 19:54427634-54427656 ATGAGGATGATGATCTATTGAGG + Intronic
1168304014 19:55424479-55424501 AGGAGGCTGAGGATCACTTGGGG + Intergenic
925633013 2:5914729-5914751 AAGAAGCTGATGATCTCCCCTGG - Intergenic
927737026 2:25533506-25533528 AAGAGTGACATGATCTCTGGGGG - Intronic
929623676 2:43384292-43384314 ATGAGGCTGTTGAGCTCTTGGGG + Intronic
929658997 2:43764252-43764274 AAGAGTCTAATGACCTTTGGAGG + Exonic
930171611 2:48257346-48257368 ATGAGGCAGATTATCTCTGATGG - Intergenic
930535642 2:52643017-52643039 CAGAAGCTGATGATCTCTTCAGG + Intergenic
932230839 2:70082986-70083008 AAGACTCTTATGTTCTCTGGGGG - Intergenic
932831820 2:74997643-74997665 AAGAAGCTCAGGATCTTTGGGGG + Intergenic
933036199 2:77401889-77401911 CACAGGCTGAGAATCTCTGGTGG + Intronic
933601737 2:84339076-84339098 AGGAGGCTGATGCTCTAGGGAGG + Intergenic
935990450 2:108714423-108714445 AAGATGCAGATGAACTCGGGAGG + Intergenic
937019898 2:118640618-118640640 AAGAGGCTGATGACCTTTCAGGG + Intergenic
938542126 2:132292095-132292117 AAGAGACTGAGGATCTCCTGAGG - Intergenic
938687847 2:133758139-133758161 AAGAGGCACATAATGTCTGGTGG + Intergenic
940133623 2:150411913-150411935 AAGAGGCTGATTATCACAGGTGG + Intergenic
943815645 2:192250754-192250776 AAGAGGCTGAGGAGCTGTGGAGG + Intergenic
948834151 2:240616569-240616591 AGGGGGCTCATGATATCTGGTGG + Intronic
1168994771 20:2124978-2125000 AAGGGACAGATGATCCCTGGGGG - Intronic
1170244830 20:14209023-14209045 AAGAGATTTATGATTTCTGGAGG + Intronic
1171086603 20:22243669-22243691 AAGAGGGGGGTGATCTCTGAGGG + Intergenic
1172789508 20:37493127-37493149 GAGAGGCTGAGGACCCCTGGTGG + Intronic
1177384253 21:20388560-20388582 AGGATGCTGATGGTCTCTAGCGG + Intergenic
1178045675 21:28691489-28691511 ATGACCCTGATGGTCTCTGGTGG + Intergenic
1178220210 21:30648097-30648119 AGTCAGCTGATGATCTCTGGAGG - Intergenic
1179625759 21:42648827-42648849 AAGAGGCTGGCATTCTCTGGGGG - Intergenic
1182815753 22:33161839-33161861 TAGAGGATGAGGATCTCTAGGGG + Intergenic
1184371180 22:44083072-44083094 TAGAGGCTGATGGGCTCAGGAGG - Intronic
1185011513 22:48317101-48317123 AGGAGGCTGATGGGCTTTGGGGG + Intergenic
1203294265 22_KI270736v1_random:25607-25629 CAGAGGTTGAGAATCTCTGGAGG - Intergenic
950727636 3:14927384-14927406 GGGAGGCTGAGGATCTCTTGAGG + Intronic
952529495 3:34248720-34248742 AGGAGGCTGCTGATGTCTTGAGG - Intergenic
953122475 3:40058690-40058712 AAAATGGTGATTATCTCTGGGGG - Intronic
953569166 3:44057744-44057766 AAGAGGCTGATGACCTCGAGAGG - Intergenic
954142986 3:48619931-48619953 CAGATGCTGAGGATCTCTGATGG - Intergenic
954202744 3:49034054-49034076 AAGAGACTGATACTCTTTGGGGG + Intronic
954214890 3:49119135-49119157 AAGCGGCTCAAGATGTCTGGCGG - Exonic
954863849 3:53712487-53712509 AAGAGGCTGTTACTCTGTGGTGG + Intronic
956961736 3:74410766-74410788 AACAGGCTGGTGTTTTCTGGTGG - Intronic
958908063 3:99963440-99963462 AAGGGGCTGACGGTCTCTGTGGG + Intronic
959965385 3:112347898-112347920 AAGAGGCTGAAAACCTCTGCAGG - Intronic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
963310313 3:143702605-143702627 ATGAAGGTGATGTTCTCTGGTGG - Intronic
964127201 3:153247124-153247146 AAGAGTCTGAGGATCACTGTTGG + Intergenic
965285933 3:166820623-166820645 CAGAGGCTGATTAGCTCTAGTGG + Intergenic
966086067 3:176068187-176068209 AAGAGGCTGATAATATATGAGGG + Intergenic
966439336 3:179926455-179926477 AAGAGGCCGAGGAGTTCTGGTGG - Intronic
967762009 3:193236750-193236772 AAGAGCATGATGATATTTGGGGG - Intergenic
969489893 4:7493163-7493185 AAGAGGATGAGAATCTCAGGTGG + Intronic
971895582 4:32589464-32589486 AAGTGGCTGATGTTTTTTGGGGG - Intergenic
976259200 4:83129667-83129689 AGGAGGTTCAAGATCTCTGGAGG - Intronic
978904193 4:113986351-113986373 ATAAGGCTCATGATCTCTGATGG + Intergenic
979426051 4:120568680-120568702 AAAGGGCTGTTGATCTCTGGTGG - Intergenic
979542275 4:121898475-121898497 AAGAGCCTGAAGATCTGAGGTGG + Intronic
982209759 4:153024869-153024891 AAGAAGCATATGATCTTTGGGGG + Intergenic
985816405 5:2131289-2131311 AACAGGCTGAATTTCTCTGGTGG - Intergenic
986064478 5:4222392-4222414 AAGAGGCTAATAAATTCTGGGGG - Intergenic
987448906 5:18056798-18056820 AGGAGACTGATGATCTCTCTGGG + Intergenic
994017992 5:94990581-94990603 AAAAGGGAGATGATCTTTGGTGG - Intronic
995424227 5:112002360-112002382 AGGGAGCTGATGATGTCTGGAGG - Intergenic
995741138 5:115357115-115357137 TAGAGGCTGCTGAGCTATGGTGG + Intergenic
995756696 5:115512883-115512905 AAGAGCTTTATGATCTATGGAGG - Intergenic
998175555 5:139899770-139899792 GAGAGGCAGAGGATCTCTGTTGG - Intronic
999407729 5:151322123-151322145 AAGGGGATGATGATTTCTGCAGG + Exonic
999424940 5:151479390-151479412 AAGGGGATGATGATCTCAGCCGG - Exonic
999881293 5:155867409-155867431 CAGAGACTGATGATATCTGGAGG + Intergenic
1001192353 5:169642854-169642876 AATAGGATGCTGATCTCAGGAGG - Intronic
1001333827 5:170781879-170781901 AAGAGACTGATTACCCCTGGTGG - Intronic
1001369247 5:171180233-171180255 AAGAAGCAAATGATCTCTGGAGG + Intronic
1002628766 5:180553575-180553597 AAGAAACTGATGAAGTCTGGGGG - Intronic
1002870364 6:1161695-1161717 AAGAGGGTGATTATCTGTGTGGG - Intergenic
1004916149 6:20334064-20334086 GAGAGGCTGATTCTCTCTGGGGG - Intergenic
1006606782 6:35263123-35263145 AAGAGACTGATGAAGTTTGGTGG - Intronic
1010236663 6:73580406-73580428 CAGAGGCTGCTGACCGCTGGGGG - Intergenic
1011236239 6:85220498-85220520 ATGAGGATGATTTTCTCTGGGGG - Intergenic
1011627130 6:89291766-89291788 AAGAAGCTGATGGTCTATTGGGG - Intronic
1013608280 6:111771123-111771145 CAGAGGCTAAAGATCTCTGTTGG - Intronic
1013929565 6:115514799-115514821 AAGAGGCTGAGGCAATCTGGGGG - Intergenic
1015323016 6:131897170-131897192 AAGAGGTTGGTGTTCTCTGTAGG - Intergenic
1015739067 6:136433948-136433970 AAGGTGCTGATGATGTCTGCAGG + Intronic
1015973871 6:138769677-138769699 GAAAGCCTGATGATCTCAGGTGG - Intronic
1016415084 6:143823713-143823735 CAGAGACTGATCATCTTTGGGGG + Exonic
1017643589 6:156517846-156517868 ATGAGGCTGATGGGCGCTGGAGG - Intergenic
1018738857 6:166712152-166712174 AAGAGGCTCAGGGTCACTGGGGG + Intronic
1018854317 6:167664537-167664559 AAGAGCCTGATGGTATCTGCAGG - Intergenic
1019087405 6:169491708-169491730 AAGAGGCTAATGATGTGTGCTGG + Intronic
1021553110 7:21892863-21892885 AAGATACTGATTATCTCTGGGGG - Intronic
1023477602 7:40597917-40597939 AGGAGGCAGATGATATCTGAAGG - Intronic
1027941116 7:84680385-84680407 AAAAGGGTGAAGATCTCTGGAGG + Intergenic
1030921337 7:115392394-115392416 AAGATTATGATGATTTCTGGGGG + Intergenic
1031558588 7:123209121-123209143 AAGAGGCTGATGATATAGGCTGG - Intergenic
1033125230 7:138701477-138701499 AAGAGGCTGCCGAACTTTGGAGG + Intergenic
1035259627 7:157653168-157653190 CAGAGGTTGGTGATGTCTGGAGG - Intronic
1035941135 8:3902503-3902525 TAATGGCTGATGATCTCAGGTGG - Intronic
1036501345 8:9317292-9317314 AAGGGGCTGATGATCACTTCTGG - Intergenic
1037680966 8:21097148-21097170 TGGAGGCTGAAGAGCTCTGGAGG + Intergenic
1037894565 8:22643244-22643266 CAGAGGCTGACCATCTGTGGAGG - Intronic
1041005775 8:53495799-53495821 CAGAGGCTGATGAACTCCTGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1042461089 8:69069893-69069915 AAGAGGCTGTTGATCTCCCCTGG - Intergenic
1044726031 8:95194979-95195001 ATGAAGTTGATGACCTCTGGGGG + Intergenic
1048853606 8:138667815-138667837 AGGAGGCACATGATGTCTGGTGG - Intronic
1053088693 9:35252407-35252429 AGGAGGCTGAGGAACTCAGGAGG - Intronic
1053194152 9:36102570-36102592 AAAAGGCTGATAGTCTCTGGGGG - Intronic
1053539159 9:38955762-38955784 AAGAGGGGGTTGCTCTCTGGCGG + Intergenic
1054626982 9:67408157-67408179 AAGAGGGGGTTGCTCTCTGGCGG - Intergenic
1054818226 9:69496207-69496229 GAGAGGCTGATTAGCTCTGGGGG - Intronic
1056249938 9:84737534-84737556 AAGAGGCAGATGAGCCCTGAGGG - Intronic
1056621185 9:88216384-88216406 AAGAGGCAGAGGATTTCTCGAGG + Intergenic
1057241241 9:93411965-93411987 ATGAGGCTGATGATTGCTGCAGG + Intergenic
1059402062 9:114076743-114076765 AGGAGGCAGGTGAGCTCTGGGGG + Intronic
1059729340 9:117041399-117041421 AATAAGCTGAGGATCTCAGGAGG - Intronic
1185491628 X:521753-521775 ATGAGGGTGATTATCCCTGGAGG - Intergenic
1186846946 X:13540360-13540382 AGGAGGCTGAGGATCCCTTGAGG + Intergenic
1188770777 X:34150926-34150948 AAAATGCTGATGATCTCTACTGG - Intergenic
1189269050 X:39737461-39737483 GAGAGGGTGAGAATCTCTGGAGG - Intergenic
1189791286 X:44607797-44607819 AGGAGGCTGAGGATCACTTGAGG + Intergenic
1192104052 X:68296097-68296119 CTGAGGCTGAGGCTCTCTGGAGG - Intronic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic
1195380729 X:104268486-104268508 AAGAGGCTGAGGATCGCTTGAGG - Intergenic
1196995281 X:121375878-121375900 AATAGGCAGATGATTTCTGCAGG - Intergenic
1199983431 X:152933744-152933766 AGGAGGCAGATGATATCTTGCGG - Intronic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic