ID: 901381816

View in Genome Browser
Species Human (GRCh38)
Location 1:8879156-8879178
Sequence ATCGCGGCGCGAGGCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901381816_901381827 12 Left 901381816 1:8879156-8879178 CCCCTCCTGCCTCGCGCCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 901381827 1:8879191-8879213 GTTGGCGTCGAGTCGTTGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 12
901381816_901381822 -6 Left 901381816 1:8879156-8879178 CCCCTCCTGCCTCGCGCCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 901381822 1:8879173-8879195 CGCGATCCGAGAGACCCCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 39
901381816_901381828 25 Left 901381816 1:8879156-8879178 CCCCTCCTGCCTCGCGCCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 901381828 1:8879204-8879226 CGTTGAGAGGCTGCGCGCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901381816 Original CRISPR ATCGCGGCGCGAGGCAGGAG GGG (reversed) Intronic
901381816 1:8879156-8879178 ATCGCGGCGCGAGGCAGGAGGGG - Intronic
905298789 1:36972038-36972060 ATCACGGAGCCAGGCAGGAGGGG + Intronic
1063418176 10:5890119-5890141 ATCGGGACGCGAGACCGGAGGGG - Intergenic
1065020391 10:21497225-21497247 GTCGCGCCGAGAGGCCGGAGGGG - Exonic
1065869654 10:29945536-29945558 ATTGTGGCTCGAGGCTGGAGAGG - Intergenic
1083656929 11:64234417-64234439 GCCGCGGCGGGAGGCGGGAGGGG + Intergenic
1084021580 11:66421011-66421033 AAGGCGGCGTGAGGCAGGCGAGG + Exonic
1084424770 11:69078670-69078692 AGCGCTGGGCGAGGCAGGAGGGG - Intronic
1096595289 12:52691298-52691320 GGCGGGGCACGAGGCAGGAGTGG - Exonic
1096623619 12:52879696-52879718 GTGCCGGCGCGAGGCAGCAGGGG - Intergenic
1098200976 12:68055330-68055352 GTCGAAGAGCGAGGCAGGAGAGG - Intergenic
1103856281 12:123973001-123973023 AACGCGGCCCGAGGGAGGGGGGG + Intronic
1114437906 14:22723518-22723540 ATGGCTGTGAGAGGCAGGAGGGG + Intergenic
1118926372 14:70193538-70193560 ATCGCTGGGAGAGGCACGAGGGG - Intergenic
1127225195 15:56919733-56919755 ACCGCGGCGCGAGCAAGGGGCGG - Intronic
1129541095 15:76347315-76347337 GTCGCCACGCGAGGCTGGAGGGG + Intergenic
1133392007 16:5418326-5418348 ATCTCGGTGGGAGGCAGGTGCGG + Intergenic
1140655673 16:77136932-77136954 ATCGCGGCTGGAGGCAGAAAAGG - Intergenic
1142514221 17:416434-416456 ATGGCGGTGAGAGGCAGGGGTGG + Intronic
1142597739 17:1037711-1037733 ATTGCAGCCTGAGGCAGGAGGGG + Intronic
1148128176 17:45247513-45247535 ATCCCTGCGGGAGGCCGGAGGGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1154529649 18:15330887-15330909 AACACGGCACGCGGCAGGAGAGG - Intergenic
1157416900 18:47510916-47510938 CTCACGGTGCCAGGCAGGAGAGG - Intergenic
1160728244 19:628109-628131 AACGCTGGGAGAGGCAGGAGGGG + Intronic
1161094446 19:2381577-2381599 AGCGTGGAGCGAGGCAGGGGCGG - Intergenic
1161471159 19:4457397-4457419 ATCTGGGGGCGGGGCAGGAGGGG - Intronic
1162486065 19:10961199-10961221 AGCGCGGCGCGGGGCCGGGGAGG + Intronic
1165349638 19:35268975-35268997 CTCACGCCGCGCGGCAGGAGGGG - Intronic
1168100281 19:54137871-54137893 ATAGCGGCGCGAAGCGGAAGTGG - Intronic
932036593 2:68252379-68252401 GCAGCGGCGAGAGGCAGGAGAGG + Exonic
941469264 2:165864130-165864152 ATAGCGACGAGAGCCAGGAGTGG - Intronic
1184402448 22:44281924-44281946 ATCGCGTGGCCAGGCAGGTGGGG - Intronic
950785107 3:15427753-15427775 ATCTGGGTGCGAGGCAGGTGCGG + Exonic
959932413 3:111998939-111998961 TTCCAGGCGCGAGGCAGCAGCGG + Exonic
966862983 3:184241045-184241067 ATGGCTGTGAGAGGCAGGAGGGG - Exonic
967131733 3:186476890-186476912 ATGGAGGAGCCAGGCAGGAGAGG + Intergenic
968505192 4:968181-968203 TTGGCGGGGCGGGGCAGGAGAGG - Intronic
970860815 4:20700557-20700579 ATCGCGGCGGGAGAGAGGCGCGG + Exonic
974017148 4:56657656-56657678 GTCACGGTGCTAGGCAGGAGAGG + Intronic
976733113 4:88284061-88284083 AGCGCGGCGCGAGGCGGGCAGGG - Intronic
1009905652 6:69867417-69867439 GTCGCGGCGCGAGGAAGACGCGG + Intronic
1016261432 6:142174847-142174869 AGCGTGTCGCAAGGCAGGAGAGG - Intronic
1035671101 8:1417651-1417673 CTCGCGGAGTGAGGCAGGAGTGG - Intergenic
1035671119 8:1417697-1417719 CTCGCCGAGTGAGGCAGGAGTGG - Intergenic
1039454145 8:37696757-37696779 ATGGCGCCGCGGGGTAGGAGAGG - Intronic
1041109354 8:54470338-54470360 AGCGCGGGGCGAGGAAGGCGGGG - Intergenic
1045488517 8:102653833-102653855 AGTGGGGCGCGAGGCAGGAAAGG + Intronic
1049423046 8:142525266-142525288 CTCCAGGCGGGAGGCAGGAGAGG + Intronic
1061175493 9:128993609-128993631 ATGGCGGCACGATGCAGCAGGGG - Exonic
1062332594 9:136051215-136051237 CTCTCTGCGCGAGGGAGGAGTGG - Intronic
1062413727 9:136437714-136437736 GCCGCGGCGGGAGGCAGGACAGG - Intronic
1192363832 X:70455152-70455174 AGCGGGGCGCGCGGGAGGAGGGG - Intronic