ID: 901383288

View in Genome Browser
Species Human (GRCh38)
Location 1:8889483-8889505
Sequence CTTCCTACGGGGACTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901383288_901383295 14 Left 901383288 1:8889483-8889505 CCTCCCCAAGTCCCCGTAGGAAG No data
Right 901383295 1:8889520-8889542 ATCTGAACTCCACTTACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901383288 Original CRISPR CTTCCTACGGGGACTTGGGG AGG (reversed) Intergenic
No off target data available for this crispr