ID: 901383363

View in Genome Browser
Species Human (GRCh38)
Location 1:8890113-8890135
Sequence GCACGGACTCCTGGCAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901383354_901383363 3 Left 901383354 1:8890087-8890109 CCCAGACCTCATACCCCGGAGCC No data
Right 901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG No data
901383355_901383363 2 Left 901383355 1:8890088-8890110 CCAGACCTCATACCCCGGAGCCT No data
Right 901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG No data
901383352_901383363 19 Left 901383352 1:8890071-8890093 CCTGTTTGGACACAGTCCCAGAC No data
Right 901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG No data
901383351_901383363 20 Left 901383351 1:8890070-8890092 CCCTGTTTGGACACAGTCCCAGA No data
Right 901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG No data
901383358_901383363 -10 Left 901383358 1:8890100-8890122 CCCCGGAGCCTACGCACGGACTC No data
Right 901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG No data
901383356_901383363 -3 Left 901383356 1:8890093-8890115 CCTCATACCCCGGAGCCTACGCA No data
Right 901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901383363 Original CRISPR GCACGGACTCCTGGCAAGAG AGG Intergenic
No off target data available for this crispr