ID: 901389413

View in Genome Browser
Species Human (GRCh38)
Location 1:8934075-8934097
Sequence TTGAAAGGTACCATGAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901389410_901389413 -5 Left 901389410 1:8934057-8934079 CCATCTGGAAATCCTCTTTTGAA No data
Right 901389413 1:8934075-8934097 TTGAAAGGTACCATGAGTCTTGG No data
901389408_901389413 15 Left 901389408 1:8934037-8934059 CCTCTTCAGATGTTAATTGGCCA No data
Right 901389413 1:8934075-8934097 TTGAAAGGTACCATGAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901389413 Original CRISPR TTGAAAGGTACCATGAGTCT TGG Intergenic
No off target data available for this crispr