ID: 901393113

View in Genome Browser
Species Human (GRCh38)
Location 1:8960367-8960389
Sequence CAACTATCAATGCTGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901393108_901393113 9 Left 901393108 1:8960335-8960357 CCCAGAGTGATTAAGCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 93
901393107_901393113 19 Left 901393107 1:8960325-8960347 CCTGAGTGGACCCAGAGTGATTA 0: 1
1: 0
2: 2
3: 8
4: 101
Right 901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 93
901393110_901393113 8 Left 901393110 1:8960336-8960358 CCAGAGTGATTAAGCAGACAGGA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901393113 Original CRISPR CAACTATCAATGCTGTGGCT GGG Intronic
901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG + Intronic
903526800 1:23996809-23996831 CAAAAATCAATGCTGTGGCCAGG - Intergenic
1063173564 10:3531542-3531564 CAAGACTCAATGCTGTGACTAGG - Intergenic
1063780701 10:9319951-9319973 CAAGTAACAATGATGTTGCTAGG + Intergenic
1065524162 10:26601481-26601503 TAATTATCCTTGCTGTGGCTGGG - Intergenic
1069546520 10:69333244-69333266 CAAATCCCAATGCTGTGGCTTGG - Intronic
1071351725 10:84753170-84753192 CAACTATGAAGGGTGGGGCTGGG + Intergenic
1071614822 10:87065872-87065894 CACCCATCAGTGCTGTGACTTGG - Intronic
1084561318 11:69907072-69907094 CAATTTTCAATCGTGTGGCTAGG + Intergenic
1087267805 11:96079886-96079908 CACCCATTAAGGCTGTGGCTGGG + Intronic
1087475118 11:98624266-98624288 CTGCTAGCATTGCTGTGGCTGGG + Intergenic
1089736613 11:120554089-120554111 CTACTATAGATGCTGTGGGTGGG - Intronic
1090277114 11:125428044-125428066 CAGCACTCAATGCTGTGGTTTGG - Intronic
1090955992 11:131513248-131513270 AAACTATCATTGCTGTTGCCAGG + Intronic
1097001154 12:55878201-55878223 CAAATAACAAAGCTGAGGCTGGG + Intergenic
1097968821 12:65610438-65610460 CAACTATGAATTCTTTGGTTGGG + Intergenic
1099362565 12:81723480-81723502 AAACTATCCATACTGTGGTTTGG + Intronic
1100177943 12:92051977-92051999 AAACAAGCAATGATGTGGCTTGG - Intronic
1101598285 12:106186863-106186885 CACATATCATTGCTGTAGCTCGG + Intergenic
1101896529 12:108761261-108761283 CAACGATTATTTCTGTGGCTGGG + Intergenic
1102800539 12:115729242-115729264 CCACTCTCAATGATGGGGCTTGG - Intergenic
1103984428 12:124758002-124758024 CAAGGATAAATGCCGTGGCTGGG + Intergenic
1108835169 13:54536422-54536444 CAAGAATTGATGCTGTGGCTCGG - Intergenic
1112697957 13:101971665-101971687 CAAATTTCTATGCTGAGGCTGGG - Intronic
1113896756 13:113769404-113769426 CAACCACCAATGCTGAGGCCTGG + Intronic
1113912587 13:113850568-113850590 CAGCTAACAGTGCAGTGGCTTGG - Intronic
1114181644 14:20373098-20373120 CAGCCGTCACTGCTGTGGCTTGG - Exonic
1114327526 14:21604186-21604208 TAATAATCAATGCTGTGGCCGGG - Intergenic
1115622848 14:35157463-35157485 GAACAATGAATGCTGTGGTTTGG - Intronic
1116051288 14:39806506-39806528 CAACTATGAATACTGTGCCATGG + Intergenic
1117226028 14:53659872-53659894 CAACTAGCAATGTTGTAGATAGG - Intergenic
1119796676 14:77404501-77404523 TAAATGTCAATGCTGTGCCTAGG - Intronic
1120174876 14:81282832-81282854 CAATTATGACTGGTGTGGCTGGG + Intronic
1120775980 14:88438652-88438674 CCACAATCAAGGCAGTGGCTGGG + Intronic
1122882210 14:104695245-104695267 CACCTACCATGGCTGTGGCTGGG - Intronic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1131356034 15:91748040-91748062 CAACTTCCAGGGCTGTGGCTGGG + Intergenic
1132538208 16:494206-494228 CAATTATAAATCCTGTTGCTGGG + Intronic
1147523499 17:41197615-41197637 AAACTATCAATGTTATAGCTGGG - Intronic
1148118001 17:45189044-45189066 CAACTCTTAATGCTGTGTGTGGG + Intergenic
1156999111 18:43503117-43503139 GCACTTTCAATGCTGTGGTTGGG - Intergenic
925285755 2:2714655-2714677 CAAATATCAATGATGTGCCAGGG + Intergenic
929489147 2:42381087-42381109 CAAAGTCCAATGCTGTGGCTAGG + Intronic
932961540 2:76418077-76418099 CAAGTATCAAAGATGTGGTTTGG + Intergenic
933394034 2:81709243-81709265 CATTTATCAATTTTGTGGCTTGG + Intergenic
935640150 2:105282527-105282549 CAAATATCAATTCTCAGGCTGGG + Intronic
936475531 2:112836419-112836441 CAACTAGCAATGTATTGGCTAGG + Intronic
937176504 2:119941756-119941778 CAAGTATAAATGCTGAGGTTGGG - Intronic
942465972 2:176208022-176208044 CAAATATAATTGCGGTGGCTGGG - Intergenic
945656848 2:212634360-212634382 AAAATATCAATGCTTTGGCCAGG - Intergenic
947851787 2:233294259-233294281 CATCCATCAATGCGGTGGCGTGG + Exonic
1172309360 20:33905783-33905805 CAATTATAAATGCTGAGGCCTGG - Intergenic
1175324496 20:58113410-58113432 CAACTATTAATACTGAAGCTGGG + Intergenic
1176188685 20:63796027-63796049 CATCTATCCAGGCTGTGGCCAGG - Intronic
1178156404 21:29858889-29858911 GAACTGCCAAAGCTGTGGCTAGG - Intronic
1183455010 22:37917854-37917876 CGACTATCATTGCAGTGACTGGG + Intronic
1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG + Intergenic
952326196 3:32322658-32322680 CAACCATCTATGCCATGGCTGGG - Intronic
953272538 3:41459415-41459437 TAACTGTCAATGGTGCGGCTCGG + Intronic
953341251 3:42135772-42135794 CATCTGTCAGTGCTCTGGCTTGG + Intronic
960242570 3:115362730-115362752 CAACTATTAAAGTGGTGGCTTGG + Intergenic
962201887 3:133406911-133406933 CAAAAAGCAATGCTGAGGCTGGG + Intronic
964666247 3:159177140-159177162 CAACTATTAATTCTTTGGCCTGG - Intronic
966247787 3:177827804-177827826 CATCCATTAATGCTTTGGCTAGG + Intergenic
969402388 4:6964089-6964111 CAAAAATCAAAGTTGTGGCTGGG - Intronic
970333557 4:15007331-15007353 CAACCATCAGAGCAGTGGCTGGG + Exonic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
977343681 4:95791824-95791846 CACCCACCAATGCTGAGGCTTGG + Intergenic
982016825 4:151162868-151162890 CAAAGACCAATCCTGTGGCTGGG - Intronic
982305559 4:153927008-153927030 CACCATTCAATGCTGTGGCAAGG - Intergenic
986444163 5:7807076-7807098 CAACTAACAATACTTTGGCAGGG + Intronic
992919863 5:81503608-81503630 CAACTAGCAATCCTGTTACTGGG + Intronic
993672436 5:90777451-90777473 CAACTATCAATGGCATAGCTGGG + Intronic
996835748 5:127790057-127790079 GATCCATCCATGCTGTGGCTAGG - Intergenic
1001437951 5:171715098-171715120 CAACTAAGAGGGCTGTGGCTTGG + Intergenic
1003078406 6:3001851-3001873 GAACTGTCACTGCTGTGGATGGG + Intronic
1004138306 6:12990275-12990297 CAACTCTCAAGGCTGGGGGTGGG - Intronic
1006123183 6:31820169-31820191 CAACTACCACTACTGTGGCATGG + Intergenic
1013450518 6:110275983-110276005 TGACAATGAATGCTGTGGCTGGG - Intronic
1014350679 6:120341165-120341187 CAACTCTTAATACTGTTGCTTGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1023320778 7:38995204-38995226 CATCTATCCATTCTGTGTCTTGG + Intronic
1038088466 8:24226970-24226992 CACTTAACATTGCTGTGGCTTGG + Intergenic
1039525855 8:38215683-38215705 AAACTATCAATCCATTGGCTAGG - Intergenic
1043729204 8:83652841-83652863 CAACTATCAATGCTGCTGATTGG - Intergenic
1043773912 8:84240807-84240829 CAACACTCAATGCTGTTACTGGG - Intronic
1045280710 8:100747294-100747316 CAAGTATGAAAGATGTGGCTGGG + Intergenic
1047474869 8:125217147-125217169 CAACTATCAAAGGGGTAGCTTGG - Intronic
1052286509 9:26791771-26791793 AATCTATCAATACTATGGCTCGG - Intergenic
1056441909 9:86630080-86630102 CAATCATGAATGCTGTGGTTAGG - Intergenic
1057740279 9:97705443-97705465 AGACTATTAATGCTGGGGCTGGG - Intergenic
1058301809 9:103383199-103383221 TACCTAGCAATGCAGTGGCTGGG - Intergenic
1060620386 9:125060348-125060370 CCACAAACAATGCTGTTGCTAGG - Intronic
1185482791 X:460230-460252 CAGCTCTCAAAGCTGTGGGTTGG + Intergenic
1186398731 X:9236873-9236895 CAACGATCATTTATGTGGCTGGG - Intergenic
1186824760 X:13328557-13328579 CTACGGTCACTGCTGTGGCTGGG - Intergenic
1186921210 X:14282688-14282710 TATCTAGCAATGCTGTTGCTGGG - Intergenic
1196409958 X:115407879-115407901 CAACTATCAGTTGTGTGACTAGG - Intergenic
1199147173 X:144381624-144381646 CATGTATCAATGGTGGGGCTAGG + Intergenic