ID: 901393930

View in Genome Browser
Species Human (GRCh38)
Location 1:8966796-8966818
Sequence CACCTGCTCCTGCTCTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901393930_901393932 -10 Left 901393930 1:8966796-8966818 CCTCTCTAGAGCAGGAGCAGGTG 0: 1
1: 0
2: 3
3: 18
4: 194
Right 901393932 1:8966809-8966831 GGAGCAGGTGTGGCTGCTGCAGG 0: 1
1: 0
2: 4
3: 82
4: 647
901393930_901393934 6 Left 901393930 1:8966796-8966818 CCTCTCTAGAGCAGGAGCAGGTG 0: 1
1: 0
2: 3
3: 18
4: 194
Right 901393934 1:8966825-8966847 CTGCAGGAGTTTTGCAGGCCTGG 0: 1
1: 2
2: 1
3: 26
4: 216
901393930_901393936 15 Left 901393930 1:8966796-8966818 CCTCTCTAGAGCAGGAGCAGGTG 0: 1
1: 0
2: 3
3: 18
4: 194
Right 901393936 1:8966834-8966856 TTTTGCAGGCCTGGTGGAAGTGG 0: 1
1: 0
2: 1
3: 28
4: 302
901393930_901393935 9 Left 901393930 1:8966796-8966818 CCTCTCTAGAGCAGGAGCAGGTG 0: 1
1: 0
2: 3
3: 18
4: 194
Right 901393935 1:8966828-8966850 CAGGAGTTTTGCAGGCCTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 285
901393930_901393933 1 Left 901393930 1:8966796-8966818 CCTCTCTAGAGCAGGAGCAGGTG 0: 1
1: 0
2: 3
3: 18
4: 194
Right 901393933 1:8966820-8966842 GGCTGCTGCAGGAGTTTTGCAGG 0: 1
1: 0
2: 1
3: 52
4: 1626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901393930 Original CRISPR CACCTGCTCCTGCTCTAGAG AGG (reversed) Intronic
901393930 1:8966796-8966818 CACCTGCTCCTGCTCTAGAGAGG - Intronic
904094756 1:27967870-27967892 CCTCTGCTCCTGCTCTCAAGGGG + Exonic
904294163 1:29507045-29507067 CAGCTGCTCCAGCTCTGAAGGGG - Intergenic
907407885 1:54264861-54264883 CACCGGCCACTGCTCTGGAGAGG + Intronic
912950738 1:114118619-114118641 CTCCTGCTGCTGCTGCAGAGGGG + Intronic
915359463 1:155277505-155277527 CGCCGACTCCTGCTCTGGAGGGG + Intronic
915838539 1:159197380-159197402 CACCTGCGCCTGCACTTGAGAGG - Intronic
916423842 1:164662030-164662052 CACCTGCATCTGGTCTAAAGAGG - Intronic
917005740 1:170415439-170415461 CACATGCTTCTTCTATAGAGAGG - Intergenic
920185862 1:204159045-204159067 CATCTCCTCTTGCTCCAGAGTGG + Intronic
921554932 1:216586684-216586706 CACCTGCCTCAGCTCCAGAGTGG + Intronic
924447631 1:244148748-244148770 CATCAGCTCCTGCTCTAGCATGG - Intergenic
1063837091 10:10027952-10027974 CACCTGCTCCAGAAATAGAGGGG + Intergenic
1064332260 10:14405001-14405023 CACATGCACCTGCTCTAGGCTGG - Intronic
1064782969 10:18863143-18863165 CTACTGCTCCTCCTCTACAGTGG - Intergenic
1065542386 10:26783512-26783534 CACCTCCTCCTGGTCTACACAGG + Intronic
1066000384 10:31099461-31099483 CACCTCCTCCTGTTTCAGAGGGG + Intergenic
1071597980 10:86942020-86942042 CTACTGCTCCTGCTACAGAGAGG - Intronic
1073180258 10:101579151-101579173 CACCTGCTCCTGCTTAAAATGGG + Exonic
1073468112 10:103706214-103706236 CAGCTGCAGGTGCTCTAGAGGGG - Intronic
1074248131 10:111714525-111714547 CACCTGCTGCAGCTGTAGGGAGG - Intergenic
1075397976 10:122141479-122141501 CAGCTGCTCCTGTTCCTGAGGGG - Intronic
1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG + Intergenic
1077037488 11:502479-502501 CACCTCCTCCTGCCCCACAGAGG + Exonic
1077050348 11:563590-563612 CAGCAGCTCCTGCCCCAGAGTGG + Exonic
1077160456 11:1110166-1110188 CAGCTGCTCCTGCTGCAAAGAGG + Intergenic
1077376559 11:2207944-2207966 CCCCTGCTCCTGCTCCTCAGAGG - Intergenic
1077411529 11:2406087-2406109 CACCTGCTCCTGCCGCAGAGTGG - Exonic
1079790233 11:24728407-24728429 CCCCTGCTTCTGCTCTAGTTAGG + Intronic
1080637990 11:34140230-34140252 AACCTGCTCCTGCCATAGAAGGG - Intronic
1083421272 11:62554580-62554602 CAGCTGTTCCTGCTGCAGAGGGG + Intronic
1084014706 11:66371638-66371660 CACCTGCACCTGCGCTGGGGCGG + Exonic
1084150493 11:67285858-67285880 CACCCCCTCCTGCTGCAGAGGGG + Exonic
1086877240 11:92111653-92111675 CACCTGCCTCTGCTGTACAGAGG - Intergenic
1091185060 11:133639429-133639451 CACCTTCTCATTCTCCAGAGAGG + Intergenic
1092923789 12:13256266-13256288 CAGCTGCTCCTGGTCTAGCTCGG - Intergenic
1099101629 12:78448541-78448563 CCCAGGCTCCAGCTCTAGAGTGG + Intergenic
1103331364 12:120156521-120156543 CACCTCCTCCTGCTCTGCAAAGG + Exonic
1104008354 12:124911724-124911746 CACTTGGTCCTGCGCTTGAGGGG - Exonic
1104904985 12:132208308-132208330 CACCTGATCTTCCTCTAGTGTGG - Intronic
1105014934 12:132780822-132780844 CTCCTTCTCCTTCTCTAGTGAGG + Exonic
1105776827 13:23670031-23670053 CAGCTGAGCCTGCTCCAGAGGGG + Intronic
1107604811 13:42047709-42047731 CACTTCCTCCTGCTCTAGTCCGG + Intronic
1108395073 13:49983953-49983975 GCCCAGCTCCTGCTCTAGATGGG - Intergenic
1109341159 13:61060734-61060756 TACCTGCTCCTGCTATGGGGTGG - Intergenic
1110312745 13:74069986-74070008 CACCAGCTAGTGCTCAAGAGAGG + Intronic
1111429869 13:88136448-88136470 CAACTGCTCCAGCCCTGGAGGGG - Intergenic
1111932206 13:94524062-94524084 CATCTCCTCCTGCTATAAAGGGG - Intergenic
1113179554 13:107609464-107609486 CCTCTGCTCCTGCTCTCAAGGGG + Intronic
1113597858 13:111547338-111547360 CACCTTCTCCACCTCTAGATAGG - Intergenic
1115653585 14:35421605-35421627 CAGCAGGGCCTGCTCTAGAGAGG - Intergenic
1123467295 15:20526604-20526626 CACCGGCTCCTGCTCCTGATAGG + Intergenic
1123650819 15:22474438-22474460 CACCGGCTCCTGCTCCTGATAGG - Intergenic
1123741227 15:23283280-23283302 CACCGGCTCCTGCTCCTGATAGG - Intergenic
1123745770 15:23319278-23319300 CACCGGCTCCTGCTCCTGATAGG + Intergenic
1124278042 15:28342595-28342617 CACCGGCTCCTGCTCCTGATAGG + Intergenic
1124304661 15:28569013-28569035 CACCGGCTCCTGCTCCTGATAGG - Intergenic
1128378164 15:67092013-67092035 CAGCTGCAACTGCTCTAGACAGG - Intronic
1129180439 15:73871075-73871097 CACCCGCTGCTGCACAAGAGGGG - Intergenic
1129799902 15:78405939-78405961 CACCTGCTCCAACCCCAGAGTGG + Intergenic
1130918359 15:88323758-88323780 CTCCTGCTCCTCCACTACAGTGG + Intergenic
1133009881 16:2905096-2905118 CACCTCCTCTCGCTCTAAAGCGG - Intergenic
1133440805 16:5819437-5819459 GCTCTGCTTCTGCTCTAGAGTGG + Intergenic
1134668304 16:16036037-16036059 CTCCAGCTCCCGGTCTAGAGTGG - Intronic
1136019343 16:27430099-27430121 CTCCTGCTGCTGCTCCAGGGAGG + Exonic
1141608158 16:85167311-85167333 GAACAGCACCTGCTCTAGAGAGG + Intergenic
1142283676 16:89162066-89162088 CACCGGCTGGTGCTTTAGAGAGG - Intergenic
1142377647 16:89714586-89714608 CTCCTGCCCCTGCTCTGGCGGGG - Intronic
1142567516 17:850273-850295 CACCTGCTCCTGCTCCCACGAGG + Intronic
1143321326 17:6070769-6070791 CACCTGCTCCGGCTGCAGGGCGG + Intronic
1144457486 17:15430943-15430965 CACCTGCCCCAGGTCTGGAGAGG + Intergenic
1144568899 17:16382565-16382587 CACCTGGTCCTGCGCCTGAGGGG + Exonic
1145360127 17:22204977-22204999 CACCTGGTCCTGCGCCTGAGGGG + Exonic
1146707662 17:35013227-35013249 CCACAGCTCCTGCTCTAGAATGG + Intronic
1147727489 17:42575356-42575378 CAGCTGCTTCTGTTCTACAGTGG + Intronic
1147978938 17:44262982-44263004 CTCCTGGTCCTCCTCCAGAGGGG + Intronic
1148465976 17:47865526-47865548 CACCTGTTCCTGCTGTTGAGGGG + Intergenic
1148640386 17:49183372-49183394 CATCTACTCCAGCTCTGGAGAGG - Intergenic
1148665885 17:49374478-49374500 CATCTGCTCCTCTTCTAGGGAGG - Intronic
1149520533 17:57315178-57315200 CTCCTGCTCTTGGTCAAGAGAGG - Intronic
1151227040 17:72655351-72655373 CACCTGCATCAGCTCCAGAGTGG + Intronic
1151403654 17:73872816-73872838 AACCTGCTCCTTATGTAGAGGGG + Intergenic
1152229315 17:79106593-79106615 CACCTGCCCCAGCTCCAGGGTGG - Intronic
1152371151 17:79889341-79889363 CCCCTGCCCCTGCTCTAGCCTGG + Intergenic
1154170404 18:12046986-12047008 CTCCTGCTCCTGCTCGAGCAGGG - Intergenic
1154322336 18:13365151-13365173 CATCTGCTCCTTCTCTCCAGGGG - Intronic
1155522272 18:26680503-26680525 CACCTGCTCCTGCCCTATGATGG - Intergenic
1156719890 18:40057435-40057457 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1160489491 18:79325156-79325178 CAGCTAGTCCTGCTCTAGACTGG - Intronic
1160793286 19:932775-932797 CACCTGCTCCTGGGCCAGTGGGG + Intronic
1161428655 19:4217961-4217983 CACCACCTCCTGCTCCAGACTGG - Exonic
1161808437 19:6458360-6458382 AACCTGCTCCTGATCTGGAGGGG + Intronic
1162480037 19:10922477-10922499 CACCTGCTCTAACTCTTGAGTGG - Exonic
1164898718 19:31899796-31899818 TAGCTCCTCCTGCTGTAGAGGGG - Intergenic
1165373613 19:35425976-35425998 ATCCTGCTCCTGCTCAAGAGAGG - Intergenic
1167507275 19:49877591-49877613 CACCCGCTCCTTCTCTAGAACGG + Exonic
1168018637 19:53593407-53593429 CACCGGCTCCTCATCTAGATTGG + Intergenic
1168102343 19:54148009-54148031 CACCTGCTCCTGCCCTCTTGGGG - Intronic
927558026 2:24049725-24049747 CACCTCCTCCGGCTCTGCAGTGG + Exonic
930010347 2:46933130-46933152 CATGGGCTCCTGCTCTGGAGAGG + Intronic
931838687 2:66126826-66126848 CACATGGTGCTGCTCTGGAGTGG + Intergenic
931843159 2:66175675-66175697 CGCCTGCTCCTCCTTTACAGCGG - Intergenic
932275545 2:70449539-70449561 CAATTGCTCCTTCTCTTGAGGGG + Exonic
933950650 2:87326608-87326630 CACCTGTGCCTCCTCTAGGGCGG - Intergenic
936329128 2:111531971-111531993 CACCTGTGCCTCCTCTAGGGCGG + Intergenic
937766125 2:125662595-125662617 TACCTGGTGCTGCTCTAGAATGG - Intergenic
938959605 2:136329451-136329473 CACCTGGTCCTGCACCTGAGGGG - Intergenic
945038997 2:205728855-205728877 CACCAGCTCCTGCTCTGCAGGGG - Intronic
945230187 2:207580129-207580151 TACCTTCTCCTCCTCTAAAGTGG - Intronic
946851237 2:223909071-223909093 AACCTGCTCCTGCTCCTCAGAGG + Intronic
948599631 2:239100913-239100935 CGCCTGCTGCTGCTCTAGAAGGG - Intronic
948887680 2:240892277-240892299 CACCCTCTCCAGCTCTGGAGTGG - Intronic
1169016439 20:2296651-2296673 CACCTGCTCCTGCTACGGGGAGG - Intronic
1169751742 20:9001578-9001600 CACCTGCTGCTAAACTAGAGAGG + Intergenic
1169914019 20:10670177-10670199 CAACTGTTCATGTTCTAGAGAGG - Intronic
1170553167 20:17494494-17494516 CACCTGCCCATTCTCTAAAGGGG + Exonic
1170839200 20:19909916-19909938 CACCTTTTCCTGCTCAAGACTGG - Intronic
1172036982 20:32018141-32018163 CACCTGCTAGTGCTCAAGACCGG + Exonic
1174645872 20:52084973-52084995 CAGCTACTCCTGCTCCAGCGCGG - Intronic
1175586324 20:60143314-60143336 CAGCGGCTTCTGCTCCAGAGAGG + Intergenic
1179971294 21:44837732-44837754 CACCTGCTCCTGCTCCAAGCCGG - Intergenic
1180044111 21:45295001-45295023 CACTTGCACTTGCTCTGGAGGGG - Intergenic
1183341368 22:37283676-37283698 GTCCTGCTCCTGCCTTAGAGAGG - Intronic
1184501446 22:44877075-44877097 CAGCTGCTCCTTCTCCAAAGAGG - Intergenic
1184916139 22:47570262-47570284 CACCTGCCCTTGCTCTCCAGAGG + Intergenic
953570500 3:44067715-44067737 CACTTCCTCCTGCTAAAGAGGGG - Intergenic
954497841 3:50982594-50982616 CACCTGCTGCTGCTGCAGAGAGG + Intronic
958859862 3:99433518-99433540 CACCTGATGCTGCGTTAGAGTGG - Intergenic
959289070 3:104449625-104449647 AACCTGCTCCAGCTCTAGGCTGG + Intergenic
960296813 3:115954809-115954831 CACCTGATCCTGTTCCAGATTGG + Intronic
961559619 3:127719471-127719493 AACCTGCTCCTGGGCTGGAGAGG + Intronic
961634105 3:128322091-128322113 AAACTGCTCCTGCTATAGAGGGG - Intronic
964691379 3:159453881-159453903 CACATGCTCCTACTCTGCAGTGG + Intronic
966837313 3:184059098-184059120 CACCCACTCCTGCTCTGGAGAGG + Intronic
969319374 4:6402571-6402593 CACCTACTCCTGGCCTAGCGCGG - Intronic
969721217 4:8893882-8893904 CACCTGGTCCTTCGCCAGAGGGG - Intergenic
970573452 4:17404946-17404968 CACCTGCTCCTGGTGCAGTGAGG - Intergenic
973145197 4:46817018-46817040 CAGCTGCTCATGCTACAGAGTGG + Intronic
975727450 4:77305849-77305871 CACAGGCTCCTGTTCTTGAGGGG + Intronic
976119447 4:81763467-81763489 TACCCACTCCTGCTCTGGAGAGG - Intronic
976786117 4:88823399-88823421 CTCCTGCTCCTGCTCCTCAGTGG + Intronic
978232139 4:106412454-106412476 CAACTCCTCCTTCTCCAGAGAGG - Intergenic
979203315 4:118005318-118005340 CACCTGACCCTGCCTTAGAGAGG + Intergenic
979250579 4:118562852-118562874 CACCTGGTCCTGCCCTTGACAGG - Intergenic
981013811 4:139952700-139952722 CACCTCCTCTTGCTCTAGAAGGG + Intronic
981542418 4:145859697-145859719 CTTCAGCACCTGCTCTAGAGAGG - Intronic
982054392 4:151533121-151533143 TACATGCTCCAGCCCTAGAGTGG - Intronic
982683691 4:158462777-158462799 CAACTGCTCATGCCCTAGGGGGG - Intronic
985382762 4:189412773-189412795 CAACTGCTCCTGCTCTAGGGAGG + Intergenic
986299718 5:6468314-6468336 CCCCTGCTCCAGCTCCAGGGAGG - Intronic
987663440 5:20906395-20906417 CATCTGCTCCTCCTCTAGAGAGG + Intergenic
988759242 5:34295792-34295814 CATCTGCTCCTCCTCTAGAGAGG - Intergenic
991996691 5:72394762-72394784 CACCTGATTCTGCTATAAAGAGG - Intergenic
1000101207 5:158018464-158018486 CACCAACCCCTGTTCTAGAGAGG + Intergenic
1001733701 5:173981153-173981175 TACCAGCTCCTGCTCTGGTGAGG + Intronic
1004924020 6:20402252-20402274 CACCAGGTACTGCTCCAGAGCGG - Exonic
1006188853 6:32195730-32195752 CTCCTGCTCCTACTCCCGAGAGG + Exonic
1006804383 6:36778731-36778753 CATCTCCTTCTGCTCTAGAGAGG - Intronic
1014309793 6:119785698-119785720 CAACTGCTCCAGGTCTAGAGGGG + Intergenic
1017079543 6:150654483-150654505 CTCCTGCACCTGCTCATGAGAGG - Intronic
1019128976 6:169859812-169859834 CATCTTCCCCTGCTCTGGAGGGG + Intergenic
1022455416 7:30554381-30554403 CTCTTGCTCCTGCTCTTGACTGG + Intergenic
1022598934 7:31738495-31738517 CACCTGGCCCTGCTCTTGACAGG + Intergenic
1026454366 7:70557859-70557881 CCCCTGCTCCAGCTCTGGAAGGG - Intronic
1026656592 7:72262023-72262045 CACCACCTCCCGCTTTAGAGAGG + Intronic
1032405433 7:131652386-131652408 CACCTGCTCCTGGCCTTGGGGGG - Intergenic
1033214474 7:139483541-139483563 CACCTGCGGCTGCTCCAGCGTGG + Exonic
1034760960 7:153671474-153671496 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1036263179 8:7256320-7256342 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036264482 8:7263942-7263964 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036265781 8:7271564-7271586 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036267083 8:7279186-7279208 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036268386 8:7286808-7286830 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036269690 8:7294430-7294452 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036298199 8:7552624-7552646 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036299504 8:7560274-7560296 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036300809 8:7567922-7567944 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036302116 8:7575568-7575590 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036303411 8:7583215-7583237 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036315224 8:7714859-7714881 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036316526 8:7722507-7722529 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036317833 8:7730155-7730177 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036319142 8:7737803-7737825 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036320449 8:7745450-7745472 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036321759 8:7753098-7753120 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036323068 8:7760746-7760768 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036324371 8:7768393-7768415 CACCTGCTAGTGCGGTAGAGAGG + Intergenic
1036351664 8:8015913-8015935 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036352972 8:8023560-8023582 CACCTGCTAGTGCGGTAGAGAGG - Intergenic
1036354264 8:8031207-8031229 CACCTGCTACTGCGGTAGAGAGG - Intergenic
1037578561 8:20230833-20230855 CAGCTGCTCATGCCCGAGAGAGG + Intergenic
1038070385 8:24006596-24006618 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1038584830 8:28779130-28779152 CTCCTGCTCCTGCTGCTGAGTGG - Intronic
1039006603 8:33045274-33045296 TACCTTCTTCAGCTCTAGAGTGG - Intergenic
1039213452 8:35241134-35241156 CTCCTGCTGCTGCTCTTGTGAGG + Intronic
1039818309 8:41114229-41114251 CACCTCCATCTGCTCCAGAGTGG + Intergenic
1041882287 8:62765465-62765487 CACCTGCCCCTAATCTAGAAAGG + Intronic
1045994248 8:108343607-108343629 TACCAGCTCCTGCTCCAGGGAGG - Intronic
1046163590 8:110398853-110398875 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1047800065 8:128299765-128299787 CTCCTTCTCCTGCTCTAAAGTGG - Intergenic
1047899678 8:129406355-129406377 CACCTGCCCCTCCCCTAAAGGGG + Intergenic
1048310863 8:133321577-133321599 CCCTTGCTCCTGCCCTAGGGAGG + Intergenic
1048835955 8:138519155-138519177 TAGGTGCTCCAGCTCTAGAGAGG + Intergenic
1049751952 8:144289092-144289114 CACCTGCACCTGCTCCTCAGTGG + Exonic
1052843023 9:33309484-33309506 AACCTGCTCCTGCTCTTTTGTGG + Intronic
1056109863 9:83384349-83384371 CAGCTGCTCCTGCCATTGAGAGG - Intronic
1056761764 9:89420503-89420525 CACACTCTCCTGCACTAGAGGGG - Intronic
1060599599 9:124869203-124869225 CACCGGCTCCTGCTCGGGGGCGG - Exonic
1061834810 9:133321822-133321844 CCACTGCTCCTGGTCAAGAGAGG - Intergenic
1061926712 9:133809481-133809503 CTCCTGCTCCTGTGCTGGAGGGG - Intronic
1187313053 X:18165051-18165073 CTCCTGCTCCAGCTCTGGAGGGG + Exonic
1188618740 X:32193092-32193114 CTCTTGCTCCTGCTCTAGCCAGG + Intronic
1190305141 X:49077734-49077756 CACCTGCTCGTGGTCTGGACAGG + Exonic
1191694948 X:63979594-63979616 CAGCTACTCCAGCTCCAGAGTGG - Intergenic
1193981026 X:88181791-88181813 CACCAGGTCCTACTATAGAGTGG - Intergenic
1202025979 Y:20524436-20524458 CACCTGTTCCTTCTATAGATAGG - Intergenic