ID: 901396087

View in Genome Browser
Species Human (GRCh38)
Location 1:8982857-8982879
Sequence TCGGCCTCCCACTTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901396087_901396095 18 Left 901396087 1:8982857-8982879 CCAGCACCAAAGTGGGAGGCCGA No data
Right 901396095 1:8982898-8982920 TCAAGAGATCGAGACCATCCTGG 0: 5988
1: 64271
2: 65934
3: 94163
4: 182685
901396087_901396093 -5 Left 901396087 1:8982857-8982879 CCAGCACCAAAGTGGGAGGCCGA No data
Right 901396093 1:8982875-8982897 GCCGAGGCGGGTGGATCATGAGG 0: 3955
1: 14186
2: 43482
3: 59782
4: 56893
901396087_901396096 27 Left 901396087 1:8982857-8982879 CCAGCACCAAAGTGGGAGGCCGA No data
Right 901396096 1:8982907-8982929 CGAGACCATCCTGGCCAACATGG 0: 8677
1: 98250
2: 195633
3: 185412
4: 103536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901396087 Original CRISPR TCGGCCTCCCACTTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr