ID: 901399677

View in Genome Browser
Species Human (GRCh38)
Location 1:9007291-9007313
Sequence GAGGCGTGCAGGTACTCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901399666_901399677 8 Left 901399666 1:9007260-9007282 CCAGGAATGGACCAGGATGGCCG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
901399665_901399677 9 Left 901399665 1:9007259-9007281 CCCAGGAATGGACCAGGATGGCC 0: 1
1: 0
2: 0
3: 26
4: 230
Right 901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
901399672_901399677 -3 Left 901399672 1:9007271-9007293 CCAGGATGGCCGGGGCGAGGGAG 0: 1
1: 0
2: 1
3: 29
4: 243
Right 901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901399677 Original CRISPR GAGGCGTGCAGGTACTCACT GGG Exonic
900387896 1:2418974-2418996 GAGGTGAGCAGGTCCTCTCTCGG - Intergenic
901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG + Exonic
904829032 1:33295012-33295034 GAGGCAGGCAGGCACTCACCTGG - Exonic
905297497 1:36963390-36963412 CAGGCATGCAGGAAATCACTGGG - Intronic
916122681 1:161542791-161542813 TAGGAATGCAGCTACTCACTGGG + Exonic
916132578 1:161624231-161624253 TAGGAATGCAGCTACTCACTGGG + Exonic
920047002 1:203139806-203139828 GAGCCGTGCTGGTATTCTCTGGG + Intronic
921082433 1:211753158-211753180 TAGGAGTGCAGGGACTCACCAGG - Intronic
1062852806 10:758732-758754 GAGGAGTTCAGGATCTCACTGGG - Intergenic
1064265671 10:13823261-13823283 GAGGCGGGCAGGTGTTCATTAGG + Intronic
1066527460 10:36296799-36296821 AAGGGGTGCAAGCACTCACTTGG + Intergenic
1076932925 10:133545854-133545876 GAGGTATCCAGGTTCTCACTGGG + Intronic
1078863930 11:15279174-15279196 GAGGGGGGCTGGTATTCACTGGG + Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082003475 11:47407530-47407552 GGGGCATGTGGGTACTCACTTGG - Intronic
1082947687 11:58777049-58777071 CAGTCGTGCAGGAACTCGCTGGG - Intergenic
1089396308 11:118138132-118138154 GAGGGATGCAGGTGCTCCCTGGG - Intronic
1097178886 12:57159697-57159719 GAGGGGTGCAGGGACCCTCTGGG - Intronic
1103685343 12:122727946-122727968 GAGGGGTCCAGGTACACATTTGG + Exonic
1103992750 12:124810162-124810184 GAGGCCTGCCGGTAATCACTGGG - Exonic
1107189211 13:37559543-37559565 GAGACTTGCAGGTACTAACAGGG + Intergenic
1115828147 14:37300638-37300660 TGGGACTGCAGGTACTCACTTGG + Intronic
1118589642 14:67391919-67391941 GAGGCGTGCAGAATCTCACAAGG + Intronic
1119036019 14:71231189-71231211 GGGGCCTCCAGGTCCTCACTGGG - Intergenic
1122168875 14:99854109-99854131 GAAGCAGGCAGGTACTCACTGGG + Intronic
1125316518 15:38438164-38438186 CAGTCATGCAGGAACTCACTGGG + Intergenic
1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG + Intronic
1139500485 16:67360164-67360186 GTTGTGTGCAGGTACTCATTGGG + Intronic
1144790088 17:17852952-17852974 GAGGCATGTGGGTCCTCACTGGG + Intronic
1147647713 17:42043667-42043689 GAGGGGTGGAGGGACTCACTGGG + Intronic
1149561143 17:57608738-57608760 GTGCCGTGCAGGTACACAGTAGG + Intronic
1154018093 18:10638005-10638027 AAGGAGTGCATCTACTCACTGGG - Intergenic
1154186776 18:12191577-12191599 AAGGAGTGCATCTACTCACTGGG + Intergenic
1154190644 18:12228378-12228400 TAGTCGTGCAGGAACTCACAAGG + Intergenic
1154216466 18:12420138-12420160 GAGGCGTGCAGGTGCTGAGCCGG + Intronic
1156549388 18:37999633-37999655 GAGTCCAACAGGTACTCACTGGG - Intergenic
1161322315 19:3646962-3646984 GAGGGGTGCAGGCGCTCACAGGG + Intronic
1161569659 19:5023578-5023600 GAGGCCGGCTGGGACTCACTGGG + Intronic
1161610255 19:5238322-5238344 GGGGCATGCAGGTCCCCACTCGG - Intronic
1165596066 19:37012011-37012033 GAGGCGGGCAGGGCCTCGCTGGG - Intronic
1165722908 19:38092500-38092522 GACGGGAGCAGGTACACACTGGG - Intronic
1166157943 19:40929057-40929079 CAGCCATGCAGGAACTCACTGGG + Intergenic
1166166811 19:40996080-40996102 CAGCTGTGCAGGAACTCACTGGG + Intronic
925203468 2:1987653-1987675 GGGGAGTGCAGGTGCTCCCTGGG + Intronic
929411007 2:41697452-41697474 GCGGCGTGCAGGTCTTCACGGGG + Intergenic
929411012 2:41697474-41697496 GCGGCGTGCAGGTCTTCACGGGG + Intergenic
929411049 2:41697672-41697694 GCGGCGTGCAGGTCTTCACGGGG + Intergenic
931502807 2:62888974-62888996 GAGGCATGCAAGTACAAACTTGG + Intronic
931532657 2:63233769-63233791 GAGGCATGCAGGCAGTCACTGGG - Intronic
932666296 2:73701400-73701422 GAGCCATGCAGGCACTCACGTGG - Intergenic
933063468 2:77767657-77767679 GAGGGCTCCAGGTGCTCACTGGG - Intergenic
936019899 2:108987018-108987040 GAGGCATGCAGGCAGTCACTAGG + Intronic
938589982 2:132727179-132727201 GAGGAGTGCAGGTCCCCTCTGGG + Intronic
946862924 2:224017112-224017134 CAGGTTTACAGGTACTCACTGGG - Intronic
1170289159 20:14748149-14748171 GAGGCGTGTAGGAACTAACTGGG - Intronic
1170874230 20:20235456-20235478 GAGACCTGCAGGGACACACTCGG + Intronic
1171544663 20:25990986-25991008 GAGGCGGGAAGGTTCTCGCTGGG - Intergenic
1173552823 20:43945326-43945348 AAGGTGTGTAGGTACTGACTTGG - Intronic
1175592036 20:60200798-60200820 GAGGTGTCCAGGTTCTCACTGGG - Intergenic
1176110942 20:63410434-63410456 GAGACGTGCAGGTTCACACAGGG - Intronic
1180244074 21:46534666-46534688 CAGGCGTGCGGGTACTCAGAAGG + Exonic
1181631334 22:24153134-24153156 GGGGTGTGAAGGTACTTACTTGG + Intronic
1182147144 22:28003498-28003520 CAGGCCTGCAGGTCCTCCCTGGG + Intronic
1182442766 22:30373806-30373828 CAGGCCTGCAGGCACTCAGTTGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
954449610 3:50564565-50564587 GAAGCCTGCAGGGACTGACTTGG - Intronic
960760561 3:121070317-121070339 CAGCCATGCAGGAACTCACTGGG + Intronic
960761778 3:121079359-121079381 CAGCCATGCAGGAACTCACTGGG + Intronic
962134803 3:132722376-132722398 CAGTCCTGCTGGTACTCACTAGG - Exonic
964475077 3:157090745-157090767 GAGGCCTGGAGGTGCCCACTGGG + Intergenic
965075827 3:163974236-163974258 GTGGGGAGGAGGTACTCACTGGG + Intergenic
965675216 3:171187720-171187742 GAGGTCTGCAGGTGCTCACCGGG - Intronic
968817878 4:2831146-2831168 GAGGCGTGCAGGGACGCCATGGG + Intronic
976769313 4:88634281-88634303 GAGCCGTGCAGATTCTCACTGGG + Intronic
983843116 4:172481871-172481893 GAGGAGTGCAGGTACTGTGTTGG - Intronic
985813785 5:2111445-2111467 GAGGGGTGCTTGTACCCACTAGG + Intergenic
992736626 5:79728251-79728273 GTAGGGTGCAGGTACACACTTGG + Intronic
993441257 5:87959632-87959654 AAGACTTGCAGTTACTCACTGGG - Intergenic
997892140 5:137686609-137686631 CAGGGGTGCAGGCACCCACTAGG - Intronic
1002429205 5:179193264-179193286 GAGGCGAGCAGTTGTTCACTCGG - Intronic
1012543759 6:100393618-100393640 GAGGCAGGCAGGTACTTCCTGGG - Exonic
1013619065 6:111872153-111872175 GAGATGTGCTGGGACTCACTGGG - Intronic
1014479423 6:121917455-121917477 AAGGCCACCAGGTACTCACTGGG + Intergenic
1015811098 6:137163085-137163107 CAGTCATGCAGGAACTCACTGGG - Intronic
1015812037 6:137170454-137170476 CAGTCATGCAGGAACTCACTGGG - Intronic
1019419751 7:945538-945560 AAGGCCAGCAGGTACACACTGGG + Intronic
1020725738 7:11811783-11811805 GATGCTTGCAGGTTTTCACTTGG + Intronic
1027003531 7:74672305-74672327 GAGGCGTGCAGATATTGCCTGGG + Intronic
1041006030 8:53497617-53497639 GAGGCGTACAGGAACACACCTGG + Intergenic
1041473334 8:58235238-58235260 CAGCCGTGCAGGAACTCGCTAGG - Intergenic
1046286738 8:112103110-112103132 TAGGCTTTCAGGTACTCTCTGGG - Intergenic
1053133060 9:35629698-35629720 GAGGCGGGCAGAGACTGACTTGG - Intronic
1055283562 9:74702889-74702911 GAGTTCTGCAGGTGCTCACTGGG + Intergenic
1055671541 9:78611699-78611721 GAAGCGTGGAGGTACGTACTTGG + Intergenic
1055837995 9:80467708-80467730 GAGCCGTGCTGTTACTCATTGGG - Intergenic
1060583520 9:124771688-124771710 GGGGCTTGAAGGTACTCACGTGG + Intergenic
1186683311 X:11898310-11898332 GAGGAAAGCAGGCACTCACTTGG + Intergenic
1190948224 X:55116785-55116807 CAGCCGTGCAGGAACTCGCTGGG - Intronic
1193325365 X:80173505-80173527 CAGTCGTGCAGGAACTCACTCGG + Intergenic