ID: 901400127

View in Genome Browser
Species Human (GRCh38)
Location 1:9010157-9010179
Sequence TGCCTGCCTGGTGCTGACGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901400127_901400132 7 Left 901400127 1:9010157-9010179 CCACCGTCAGCACCAGGCAGGCA 0: 1
1: 0
2: 0
3: 20
4: 270
Right 901400132 1:9010187-9010209 AGATGCCGTAGCCGGCCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 50
901400127_901400133 10 Left 901400127 1:9010157-9010179 CCACCGTCAGCACCAGGCAGGCA 0: 1
1: 0
2: 0
3: 20
4: 270
Right 901400133 1:9010190-9010212 TGCCGTAGCCGGCCAGCAGGAGG 0: 1
1: 0
2: 3
3: 14
4: 91
901400127_901400130 -1 Left 901400127 1:9010157-9010179 CCACCGTCAGCACCAGGCAGGCA 0: 1
1: 0
2: 0
3: 20
4: 270
Right 901400130 1:9010179-9010201 AGAGCCGCAGATGCCGTAGCCGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901400127 Original CRISPR TGCCTGCCTGGTGCTGACGG TGG (reversed) Exonic
900159967 1:1218850-1218872 TGCAGACCTGCTGCTGACGGAGG - Exonic
900400016 1:2469206-2469228 TGCCTGCCTGCTGTGGACAGGGG + Intronic
900412093 1:2517196-2517218 CCCCTGCCTAGTGCTGGCGGTGG + Intronic
900905106 1:5551614-5551636 TGCCTGCCAGGAGATGAGGGTGG - Intergenic
901160239 1:7171775-7171797 TGCCTGCCAGGAGCTGTAGGAGG - Intronic
901194550 1:7433120-7433142 TGCCTGCCTCCTGCTCATGGAGG + Intronic
901266492 1:7914346-7914368 TGCCCTCCTGGTGCTCACGGTGG - Intergenic
901400127 1:9010157-9010179 TGCCTGCCTGGTGCTGACGGTGG - Exonic
901777962 1:11573645-11573667 TGCCTGCCTGGATCTTATGGTGG - Intergenic
902315795 1:15617574-15617596 GGCCTGGCTGGTGCTGCGGGAGG - Exonic
902513402 1:16978009-16978031 TGCCTGCCTGCTGCTGTGGAAGG + Intronic
902612453 1:17605158-17605180 GGCCTGCCTGGGGCTGATGTGGG + Intronic
906284941 1:44581097-44581119 TGCCTGTCTGGTGCTGATCGGGG + Intronic
907782259 1:57578011-57578033 TGGCTGCCTGGTGGTGGCAGTGG - Intronic
907909093 1:58811570-58811592 TACCTGCCTGGTTCTCAAGGTGG + Intergenic
912302023 1:108527895-108527917 TGGCTGCCAGGGGCTGAGGGAGG - Intergenic
912391684 1:109307248-109307270 TCCCTCCCTGGTGCTGTGGGGGG - Intergenic
912549049 1:110472741-110472763 AGCCTGCCTGGTCCCGCCGGCGG + Intergenic
912806119 1:112758400-112758422 GTCCTGCCTGGTGGTGGCGGTGG + Intergenic
914921512 1:151850710-151850732 TGCCTGGCTGCTGCTGGCTGTGG - Intronic
915146848 1:153800568-153800590 TGCCCGCCTGGTTGTGACAGGGG + Intergenic
919278093 1:195446833-195446855 TACCTGTCTGGTGCTGTCAGTGG - Intergenic
920432767 1:205929263-205929285 TGCCTTCCTGGTGCTGGTGAAGG - Exonic
921360754 1:214329317-214329339 TGCCTGCCTGGTGGTGCCCGTGG + Intronic
922897729 1:229113488-229113510 TTCCTGGCTGGTCCTGATGGTGG - Intergenic
923131229 1:231076523-231076545 TGCCTGCCTGCTGGAGAAGGAGG - Intergenic
924455651 1:244217037-244217059 GGCCTTCCTGTTGCTGACTGGGG + Intergenic
1063766423 10:9146516-9146538 TGATTGCCTGGGGCTGAGGGGGG - Intergenic
1064035157 10:11908621-11908643 TGCCTGCCAGCTGCAGACTGGGG + Intergenic
1064263450 10:13804896-13804918 TGCCTGATTGGTGCTGTCTGGGG - Intronic
1067290030 10:44933709-44933731 GGCCTACCTGCTGCTGTCGGTGG + Exonic
1069058170 10:63866269-63866291 AGTCTCCCTGGTGCTGAGGGTGG - Intergenic
1069589459 10:69632834-69632856 CACCTGCCTGCTGCTGGCGGGGG - Exonic
1070201119 10:74207337-74207359 TGCCTGCAAGGTGCTGAGTGGGG + Intronic
1071913424 10:90262500-90262522 TGGCTGCCAGGGGCTGAGGGAGG + Intergenic
1073187600 10:101625993-101626015 GGCCTGCCAGTTGCTGATGGGGG + Intronic
1074113210 10:110437255-110437277 TGCCTGCCTGCTTCAGAGGGTGG + Intergenic
1074907649 10:117879177-117879199 TGCCTGACCTGTGCTGATGGAGG + Intergenic
1075681645 10:124337684-124337706 GCCCTGCCTGGCACTGACGGGGG + Intergenic
1076368233 10:129935859-129935881 TGCCTGCCTGTGGCTGATCGTGG - Intronic
1077096556 11:801534-801556 TGCCTGCCTGGTGCCACCGGAGG - Exonic
1077303836 11:1859042-1859064 TGCCTGCCTCCTCCTGCCGGGGG - Intronic
1077464887 11:2729071-2729093 TGCCCGCCTGGGGCAGGCGGGGG - Intronic
1077555155 11:3222449-3222471 TGGCTGCCTGGGCCTGACCGGGG - Intergenic
1081915071 11:46725553-46725575 TGGCTGCCTGGAGCTGCTGGAGG - Intronic
1082562999 11:54641868-54641890 TTCCTGCCTGGTGCTGAGGTGGG + Intergenic
1083816151 11:65133553-65133575 GGCCAGCCTGGCGCTGACCGGGG - Exonic
1084605034 11:70167504-70167526 TCCCTGCCTGATGCTTATGGAGG - Intronic
1085046143 11:73354862-73354884 TACCTGCTTGATGCTGATGGCGG - Intronic
1087381374 11:97408961-97408983 GGCCAGCCTGGTGCTGGGGGTGG - Intergenic
1088818053 11:113434781-113434803 TCTCTGGCTGGTGCTGATGGGGG - Intronic
1089665226 11:120013891-120013913 TGCCTGTCTGGTGCCGAAGCCGG - Intergenic
1089851349 11:121499389-121499411 TCCTTGCCTGATGCTGACGTGGG - Intronic
1090211434 11:124923540-124923562 TGCCTGGCTGATGCTGGTGGTGG + Intronic
1090661569 11:128885940-128885962 TGGATGTCTGGTGATGACGGGGG - Intergenic
1092046716 12:5436160-5436182 TGCCTGTCTGGAGCAGACGATGG + Intronic
1092168095 12:6355269-6355291 TGCCTTCCTCATGCTGATGGAGG + Exonic
1096521235 12:52185899-52185921 TGCCTGCCTGGGGCTGGGGCGGG + Intronic
1096823128 12:54253011-54253033 TGAATGCCTGGGGCTGAGGGAGG + Intronic
1102474300 12:113178933-113178955 TGCCTGCATGGTGGTGACCCTGG + Intronic
1104892320 12:132146168-132146190 TGGCTGCCTGGGGCTGGGGGTGG - Intronic
1105205113 13:18216719-18216741 GGCCTGGCTGGTGCAGACAGTGG - Intergenic
1105928223 13:25027421-25027443 TGGCTGCCAGGGGCTGATGGGGG - Intergenic
1105942667 13:25163666-25163688 TGGCTGCCAGGGGCTGATGGGGG + Intronic
1108063292 13:46553489-46553511 TTCCTCCGTGGTGCTGATGGTGG - Exonic
1108359025 13:49652596-49652618 AGCCTGCCTGCTGCTGGGGGTGG + Intergenic
1109116749 13:58398290-58398312 GGGCTGCCTGGTGCTGACAGAGG + Intergenic
1110062182 13:71056154-71056176 TGCATGCCTGGTGCTGTCAGTGG - Intergenic
1112846395 13:103648456-103648478 TGCCAGCATGGTGTTGAAGGAGG - Intergenic
1113949521 13:114064307-114064329 TTCCTGCCGGGTGCTCACCGTGG - Intronic
1113962810 13:114134505-114134527 TGCAAGCCTGGTGCTCACTGGGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118257999 14:64221741-64221763 TGCCTCTCTGGGGCTGACAGAGG - Intronic
1120836245 14:89040738-89040760 TGCCGGCCTGCTGCTGGCCGGGG + Intergenic
1120862314 14:89265947-89265969 TGCCTCACTGGTGGTGAAGGAGG + Intronic
1121442889 14:93959822-93959844 TGCCTCCCTGGGGCTGACCTGGG - Intronic
1122247370 14:100413335-100413357 TGGCTGCCTGGGGCTGAGGTTGG - Intronic
1124041379 15:26108518-26108540 TGGCTGCCTGGGGCTGGAGGAGG + Intergenic
1124407351 15:29404474-29404496 AGCCTGCTGGGTGCTGAAGGGGG - Intronic
1124424895 15:29555651-29555673 TGCCTGCCTGGCGCAGGTGGGGG - Intronic
1124499202 15:30211939-30211961 TGGCTTCCTGGTGCTGCAGGTGG - Intergenic
1124744377 15:32326731-32326753 TGGCTTCCTGGTGCTGCAGGTGG + Intergenic
1126725307 15:51625380-51625402 TGGTTGCCTGGGGCTGAAGGTGG + Intergenic
1127969404 15:63946746-63946768 GGCCTGCCTGCTGCTGAGTGAGG + Intronic
1128246004 15:66133256-66133278 TGCCTGCCTTGTGCTGGTGTGGG - Intronic
1128261669 15:66237011-66237033 TGCCTGGATGGTGCTGCCAGTGG - Intronic
1128633605 15:69288749-69288771 TGCCTGGTTGGTGCTGCCTGTGG - Intergenic
1130656319 15:85794311-85794333 TGCCTGCCTGGCGCAGAGCGAGG - Intronic
1131713002 15:95075941-95075963 TGGGTGCCTGGTGGTGACAGAGG + Intergenic
1132557445 16:578843-578865 GGCCTGCCTGGGCCTGACGGTGG + Exonic
1132674629 16:1116627-1116649 TTCCAGGCTGGTGCTGGCGGTGG - Intergenic
1132862516 16:2078596-2078618 CGCCTGCCTGAGGGTGACGGTGG + Intronic
1133474238 16:6104577-6104599 TGGTTGCCTGGGGCTGAGGGTGG - Intronic
1136626417 16:31464802-31464824 GGCCTGGCTGGTGCTGGGGGTGG + Exonic
1139231096 16:65283278-65283300 GGCCTGTCTGGTGCTGAGGGGGG + Intergenic
1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG + Intronic
1140475012 16:75235452-75235474 TGCCTGCCAGGTCCAGAAGGTGG + Exonic
1142129337 16:88425627-88425649 TGCCTCCCTTGTGCTCACGGTGG - Intergenic
1143266179 17:5639688-5639710 TGCCTGCCTGGCTCAGACGCCGG - Intergenic
1143993185 17:10984425-10984447 TGCCTGCTTTGTGCTGAATGAGG - Intergenic
1144574242 17:16418863-16418885 TGGCTTCCTGGTGCTGACAAAGG + Intronic
1144725398 17:17499386-17499408 TTCCTGCCTGGGGCTGGTGGGGG - Intergenic
1144855016 17:18262801-18262823 TGCCCGCCTGGTGCTGGGCGTGG + Exonic
1146160188 17:30555405-30555427 TGCCTCCCGGGAGCTGACAGGGG - Intergenic
1146787471 17:35732073-35732095 TGCCTGCAAGGTGCTGGAGGCGG + Intronic
1146929472 17:36767575-36767597 TGCCTACCTGCTGCTGGAGGTGG + Intergenic
1147055349 17:37829954-37829976 TGGCAGCCAGGTGCTGACTGTGG - Intergenic
1147448929 17:40491801-40491823 CGCCTGCCTGGGGCTGGCGCCGG - Intronic
1149599155 17:57882072-57882094 TGCCTGCCAGGTGCTCCAGGGGG + Intronic
1151299769 17:73215607-73215629 TGCCAGCATGGTGCTGAGGTGGG - Intronic
1151664153 17:75535875-75535897 TGCCGGCCAGGTGCAGACGTGGG + Intronic
1152191498 17:78891021-78891043 TGTCTGCCTGGTCTTGAAGGTGG + Exonic
1152471736 17:80493299-80493321 TGCCTGCCTGGCTCTGCCTGGGG + Intergenic
1152599719 17:81256080-81256102 TCACTGCCAGGTGCTGACGCAGG + Intronic
1153488862 18:5628892-5628914 GGCCTGGCTGGTGCTGCGGGAGG - Intronic
1154323966 18:13376495-13376517 CTCCTGCCTGGATCTGACGGTGG + Intronic
1156408131 18:36802248-36802270 GCCCTGCCTGGTGCTGACTGAGG + Intronic
1156941950 18:42778613-42778635 TGCTGGCCTGGTGCTGTCAGGGG - Intronic
1157709116 18:49836708-49836730 TACCTGCTGGGTGCTGAGGGAGG + Exonic
1159091181 18:63851305-63851327 TGCTTCCCTGGTGCTAACAGTGG - Intergenic
1160308172 18:77760774-77760796 TGCCTGCCTGAAGCTGAGGAAGG + Intergenic
1160333457 18:78016322-78016344 TGGTTGCCAGGTGCTGAGGGAGG + Intergenic
1161228162 19:3157594-3157616 TGCCTGGCTGGGGCTGAGGCGGG - Intronic
1161359691 19:3840915-3840937 TGCATGGCTGGTGGTGACCGGGG + Intronic
1161963443 19:7535184-7535206 TGCCTGCAGGCTGCTGACAGTGG + Intronic
1162015222 19:7841844-7841866 CTCCTTCCTGGTGCTGACTGAGG - Intronic
1163052696 19:14696351-14696373 TGGCTGCCAGGGGCTGAGGGAGG - Intronic
1163381443 19:16971571-16971593 TGACTGCCAGGGGCTGAGGGAGG + Intronic
1163620009 19:18353651-18353673 TGGCTGCCAGGGGCTGAGGGAGG - Intronic
1164541909 19:29127875-29127897 TGCCTGCCTGGTGTTGTGGTGGG - Intergenic
1166048354 19:40242766-40242788 TGCTTGCCTGTTGCTGGGGGTGG - Intronic
1166631641 19:44412149-44412171 TGGGTGCCTGGGGCTGACCGCGG - Intergenic
1166636535 19:44456472-44456494 TGGGTGCCTGGGGCTGACAGCGG + Intergenic
1167748815 19:51367985-51368007 GGCGTGCATGGTGCTGGCGGTGG - Exonic
1168243458 19:55098556-55098578 TGCCTGCCTGGTGGTGGGGGCGG - Intronic
1202648604 1_KI270706v1_random:161494-161516 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
925781726 2:7387848-7387870 TGCCAGCCTGGTGATGGTGGGGG + Intergenic
925835865 2:7946309-7946331 TGCCTGGCTGATGCAGACTGCGG + Intergenic
928230574 2:29495205-29495227 TGCCTGCTTCGTGCTGCAGGAGG + Intronic
929318836 2:40515099-40515121 AGCCTTCCTGGTGGTGATGGTGG - Intronic
929501271 2:42493575-42493597 TGCCTGCCCGTGGCTGACGGGGG + Exonic
930688343 2:54332408-54332430 TGCGTGCCAGGTGCTGTTGGAGG - Intronic
932125731 2:69144188-69144210 TCCCTTCCTGGTGCTCACAGAGG + Intronic
933774869 2:85765806-85765828 TGCCTGGCTGGTGAGGAAGGAGG + Intronic
936255006 2:110903953-110903975 TGCCTGCATGGGGCTGATGGTGG + Intronic
936701866 2:115020579-115020601 GACCTGTCTAGTGCTGACGGTGG - Intronic
937208604 2:120252937-120252959 TGCGGGCCGGGTGCGGACGGCGG + Exonic
937423943 2:121781763-121781785 GGAGTGCCTGGTGCTGCCGGTGG + Intergenic
938541367 2:132286526-132286548 TGGGTGCCTGGGGCTGACTGCGG + Intergenic
941099667 2:161282115-161282137 TGTGTGCCTGGGGCTGACTGTGG - Intergenic
946913883 2:224495457-224495479 TGGCTGCCTGGGGCTGGAGGTGG + Intronic
948606426 2:239138761-239138783 TGCCTGCCTGGTTCTGTCCCTGG + Intronic
1169379719 20:5096058-5096080 TCCCTGACAGCTGCTGACGGAGG - Intronic
1171410999 20:24949151-24949173 TGCCTGCGTGGTGCTGGGGAGGG - Intergenic
1171546970 20:26009992-26010014 TGGCTGCGTGGTGCTGACTCTGG + Intergenic
1171870268 20:30519548-30519570 TGAGTGCCTGGGGCTGACTGCGG + Intergenic
1172605683 20:36212055-36212077 GGCCTGCCTGGTCCTGGTGGTGG + Intronic
1172972102 20:38881206-38881228 CGGCTGCCTGGAGCTGAGGGTGG - Intronic
1173625188 20:44467279-44467301 TGGGTGGCTGGTACTGACGGAGG + Intergenic
1174386127 20:50189600-50189622 TCCCTGCCCTGTGCTTACGGTGG - Intergenic
1174443931 20:50577783-50577805 TGCCTGCCTGGAGCAGCTGGTGG + Intronic
1175079510 20:56407488-56407510 TGCCTGCTTGGTGCTGGCTCAGG + Intergenic
1175723201 20:61300112-61300134 AGCCTGCTTGGAGCTTACGGTGG + Intronic
1176603250 21:8811193-8811215 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1178981667 21:37269681-37269703 GTACTGCCCGGTGCTGACGGCGG - Intergenic
1179892665 21:44344813-44344835 TGTGTGCCTGGTGATGGCGGTGG - Intergenic
1179911764 21:44454681-44454703 TGCTTGCCTGGGGATGAGGGAGG + Intergenic
1180009694 21:45041075-45041097 TGTCTGCGTGGTGATGAAGGTGG + Intergenic
1180345536 22:11702750-11702772 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1180352183 22:11814562-11814584 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1180353298 22:11820991-11821013 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1180384942 22:12171366-12171388 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1180386024 22:12177504-12177526 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1180715924 22:17872261-17872283 GGCCAGCCTGCTGCTGACGAGGG + Intronic
1180978796 22:19868931-19868953 TGGCTGTCTGGTCCTCACGGCGG + Intergenic
1181835537 22:25604738-25604760 TGCCTGCCTCGTGGTTACTGAGG + Intronic
1183712156 22:39511372-39511394 TGCCCGGCTGGTGCTGGGGGTGG + Exonic
1184292296 22:43503897-43503919 TCCCTGCGTGGTGCTGGGGGAGG - Intronic
1184653921 22:45931831-45931853 TGCATGCCTGGTCCCCACGGGGG - Intronic
1185322224 22:50206875-50206897 TCCCTGCCTGGTGCTTCTGGGGG + Intronic
950241352 3:11372616-11372638 TGGTTGCCTGGGGCTGAGGGTGG - Intronic
954124312 3:48519714-48519736 TGCCTGCCTAGTGGTCACAGTGG + Exonic
954758090 3:52853434-52853456 TGGCTACCTGGTGCTGGTGGTGG - Intronic
954786420 3:53096173-53096195 TGCTCTCCTGGAGCTGACGGTGG - Intronic
958936501 3:100261232-100261254 TGCCTGCCTGGTTCTGCCCAAGG + Intronic
962759191 3:138493122-138493144 TGCCTGCCTGGGGTTGGGGGAGG + Intergenic
965773922 3:172209237-172209259 TGGCTGCCTAGTGCTGGCAGAGG + Intronic
967456927 3:189698993-189699015 TGCCTGCCAAGTGCTGACCACGG + Intronic
968195532 3:196703379-196703401 TGGCTGCCTGGGGCTGAGGATGG - Intronic
968749337 4:2379133-2379155 TGCCAGCATGGTGCAGACTGGGG - Intronic
969486898 4:7477398-7477420 TGGCTGACTGGGGCTGACCGTGG + Intronic
972845565 4:42984864-42984886 ACCCTGCCTGGTGCTGAAGTGGG + Intronic
973374829 4:49279458-49279480 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973375733 4:49285480-49285502 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973376632 4:49291499-49291521 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973377551 4:49297651-49297673 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973378470 4:49303787-49303809 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973379691 4:49311576-49311598 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973380592 4:49317716-49317738 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973381678 4:49324761-49324783 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973382582 4:49330783-49330805 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
982238740 4:153277382-153277404 TTCCTCCCTGGTGCTCACTGTGG + Intronic
983510180 4:168601452-168601474 TGTGTGGCTGGTGGTGACGGTGG - Intronic
983871089 4:172826096-172826118 AGCCAGCCTGCTGCTCACGGTGG - Intronic
985685723 5:1280604-1280626 AGGCTCCCTGGTGCTGATGGTGG - Intronic
985712295 5:1436126-1436148 TGCCTGGCCAGTGCTGACAGTGG - Intronic
985786444 5:1897813-1897835 TGCCTGCCTGTGCCTGAGGGAGG + Intergenic
986642686 5:9888024-9888046 TGCCTCCCTGGTGCTCTCAGCGG - Intergenic
987044848 5:14098398-14098420 GGCTTGCCTGGGGCTGAGGGAGG + Intergenic
987962083 5:24823836-24823858 TGCCTCCCTGGGGCTGAGTGGGG - Intergenic
991609499 5:68435812-68435834 TCCCTGCCCTGTGCTGCCGGAGG - Intergenic
995121545 5:108541050-108541072 TGACTGCCTGGGGCTGGCAGTGG + Intergenic
997654547 5:135545417-135545439 TGGCTGCCTGGGGATGGCGGTGG + Intergenic
998523403 5:142820492-142820514 TGCCATCCTGGAGCTGAAGGCGG + Intronic
999178147 5:149646714-149646736 TGCCTGCCTGTCAGTGACGGAGG - Intergenic
1002771216 6:292228-292250 GGCCTGCCCGGTGCGCACGGGGG + Intronic
1004055397 6:12132188-12132210 TTCCTTCCTGGTCCTGAGGGAGG + Intronic
1007445994 6:41906739-41906761 TCCCTGCCTGGTACTGGTGGGGG - Exonic
1010110036 6:72216414-72216436 GGCCAGCCTAGTGCTAACGGTGG - Intronic
1017886004 6:158599891-158599913 TGCTTGGCTGCTGCTGACAGGGG + Intronic
1018076657 6:160222426-160222448 TGCCTGCCTGGCACTGGCGCTGG + Intronic
1019279161 7:191872-191894 TTCCTGCTTGGGGCCGACGGGGG - Intergenic
1019302924 7:317945-317967 TGCCTCCCTGCTGTTGACTGAGG - Intergenic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1019865595 7:3707621-3707643 TGTCTGTCTGGTGCTGTCAGTGG + Intronic
1020115553 7:5474159-5474181 TGGGTGCCTGGGGCTGAGGGAGG + Intronic
1023891431 7:44394758-44394780 TGCCCACATGGTGCTGATGGTGG - Intronic
1026343336 7:69452872-69452894 TGCCTGCTAGGGGCTGAGGGAGG + Intergenic
1030367818 7:108665865-108665887 TGGTTGCCTGGGGCTGAGGGTGG - Intergenic
1032324498 7:130914448-130914470 TGCCTGCATGGTGGGGAGGGGGG + Intergenic
1033259881 7:139833877-139833899 AACCTGTCTGGTGCTGTCGGTGG - Intronic
1034343697 7:150373019-150373041 TGCCTGCCTAGTGCTGGAGTAGG + Intronic
1034412643 7:150949216-150949238 TGCCTGCTGGGAGCTGAGGGAGG - Intronic
1035137017 7:156713594-156713616 TGGCTGCCTGGAGCTGATGGTGG + Intronic
1038328774 8:26591504-26591526 TGCATGCCTGGAGCTGGCTGTGG + Intronic
1040474000 8:47761090-47761112 TGGCTGCCAGGACCTGACGGTGG + Intergenic
1041047266 8:53899579-53899601 TGGCTGCCTGGGGCTGCTGGAGG - Intronic
1042022243 8:64380074-64380096 TCCCTGCCTGGCGCTGTCCGCGG + Intergenic
1042373718 8:68022797-68022819 TGTATGCCTGGTGCTAACGGTGG - Intronic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1043115779 8:76252175-76252197 TGCTTGCCTGGTGGTGAGAGTGG - Intergenic
1043386163 8:79749891-79749913 TGGCTGCCTGGGGCTAAAGGTGG + Intergenic
1047783671 8:128132759-128132781 TGCCTGACTGCTGCTGACCCGGG - Intergenic
1048294865 8:133206713-133206735 AGCCTGCCTGGGGCCGAGGGAGG + Intronic
1049359372 8:142204683-142204705 AGGCTGCCAGGTGCTGAGGGGGG + Intergenic
1049379043 8:142302938-142302960 TCCATGCTTAGTGCTGACGGAGG - Intronic
1049782698 8:144436063-144436085 TGCCCGGCTGGTGCTGGCTGTGG + Exonic
1050721912 9:8600457-8600479 TTGCTGCCTGGTGTTGATGGAGG - Intronic
1055895639 9:81171949-81171971 TGGTTGCCTGGGGCTGAGGGTGG - Intergenic
1055915258 9:81394097-81394119 AGCCTGCCTGGTGGGGATGGTGG - Intergenic
1057239602 9:93397050-93397072 TGCCTGCCAGGGGCTGAGGGTGG + Intergenic
1060781471 9:126416339-126416361 TGACTCCCTGGTGCTGGCGCTGG + Intronic
1061888411 9:133605062-133605084 TGCTTGCCAGGTGCAGACCGAGG + Intergenic
1062290418 9:135791912-135791934 TGCCCACCTGGTGCTCAGGGGGG - Intronic
1062585020 9:137245300-137245322 TGGCTGCCTGGTGCTGCCTGGGG + Exonic
1062585044 9:137245398-137245420 TTCCTGCCTGGTGGGCACGGAGG + Exonic
1062657520 9:137611977-137611999 TCCCTGCCTGGTCCTGGTGGGGG - Intronic
1062682510 9:137789292-137789314 TGCCGGCCTGGTGCTGGCGCAGG + Intronic
1203698539 Un_GL000214v1:117563-117585 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203699458 Un_GL000214v1:123714-123736 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203700404 Un_GL000214v1:129997-130019 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203701319 Un_GL000214v1:136017-136039 TGGGTGCCTGTTGCTGACTGTGG + Intergenic
1203480149 Un_GL000224v1:4600-4622 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203481116 Un_GL000224v1:10928-10950 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203482080 Un_GL000224v1:17237-17259 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203548645 Un_KI270743v1:150957-150979 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203549772 Un_KI270743v1:157448-157470 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1203550711 Un_KI270743v1:163613-163635 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1203568109 Un_KI270744v1:108708-108730 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203569750 Un_KI270744v1:119951-119973 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1186513773 X:10150670-10150692 ATTCTGCCTGGTGCAGACGGAGG + Intergenic
1186845850 X:13530189-13530211 TGGTTGCCTGGAGCTGAAGGTGG - Intergenic
1188554699 X:31398809-31398831 TGCCTCACTGGAGCTGAAGGAGG + Intronic
1192036556 X:67568900-67568922 TGCCTGCCTGAAGCTGCTGGAGG + Intronic
1192374604 X:70547206-70547228 TGGTTGCCTGGAGCTGAAGGTGG + Intronic
1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1192520466 X:71796220-71796242 GGCCTGCCTGGTGATGAGGTGGG - Intergenic
1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1193578737 X:83234942-83234964 GGCCTGTCTAGTGCTGACTGTGG - Intergenic
1193662818 X:84277573-84277595 TGACTGCCAGGAGCTGAGGGAGG + Intergenic
1193894812 X:87100166-87100188 TTGCTGCCTGGTGCTGCAGGAGG - Intergenic
1196753076 X:119134939-119134961 TGCCTGCCTGGCACAGACTGAGG - Intronic
1196771749 X:119301373-119301395 CTCCTGCCTGGTGCTGTCAGAGG - Intergenic
1197242934 X:124139084-124139106 TGCATCCCTGGTGTTAACGGTGG + Intronic
1197276854 X:124489536-124489558 TGGTTGCCTGGAGCTGAGGGAGG - Intronic
1198046998 X:132913248-132913270 TGGCTGCCTGGCACTGGCGGAGG - Intronic
1199855092 X:151753361-151753383 TGTTTGCCTGGTGCTGGAGGGGG + Intergenic
1200060132 X:153480399-153480421 TGGTGGCCTGCTGCTGACGGTGG + Intronic
1200111594 X:153743558-153743580 TGCCCGCCTGAGCCTGACGGAGG + Exonic
1200152215 X:153956788-153956810 TACCAGCCTGGTGGTGACGTTGG - Intronic
1201243958 Y:11985589-11985611 TGACTGCGTGGTGCTCAAGGTGG + Intergenic