ID: 901409885

View in Genome Browser
Species Human (GRCh38)
Location 1:9075408-9075430
Sequence CGGTATCAGCAGAAGAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901409885 Original CRISPR CGGTATCAGCAGAAGAGGAG CGG (reversed) Intronic
900985991 1:6073013-6073035 CAGTCTCAGCAGAGGAGGTGAGG + Intronic
901246131 1:7732677-7732699 CCGCATCAGCAGCAGAGAAGAGG - Intronic
901409885 1:9075408-9075430 CGGTATCAGCAGAAGAGGAGCGG - Intronic
902139024 1:14336005-14336027 CGGAAGTAGCAGCAGAGGAGAGG + Intergenic
904266036 1:29319041-29319063 GGGTGTCAGCTGAAGGGGAGGGG + Intronic
905188282 1:36212751-36212773 TGCTACCAGAAGAAGAGGAGTGG + Intergenic
906246400 1:44277644-44277666 GTGTTTCAGAAGAAGAGGAGTGG - Intronic
907895663 1:58687797-58687819 AGGTATCGGCAGAAGAGGTCTGG - Intronic
917065036 1:171083547-171083569 CGGCCTGAGCTGAAGAGGAGAGG + Intergenic
918047405 1:180949654-180949676 GGGCATGTGCAGAAGAGGAGAGG + Exonic
918213693 1:182374575-182374597 AGGTCACAGCAGAAGGGGAGGGG - Intergenic
921344710 1:214170559-214170581 AGGTATGAGCAGGACAGGAGAGG + Intergenic
924014882 1:239710537-239710559 GGGTATGAGGAGATGAGGAGGGG + Intronic
924770482 1:247075562-247075584 CGCTATCACCAGAACAGCAGGGG - Intronic
1063861435 10:10312092-10312114 AGGCATCAGCAGTAGATGAGAGG - Intergenic
1064364714 10:14697258-14697280 GGGTCTCAGGAGAGGAGGAGAGG - Intronic
1065207765 10:23373356-23373378 AGATAGCAGGAGAAGAGGAGTGG - Intergenic
1065954857 10:30684435-30684457 GGGTATCAGGAAAGGAGGAGGGG - Intergenic
1069876891 10:71568560-71568582 TGGAAGCAGCAGAACAGGAGGGG + Intronic
1070938720 10:80323492-80323514 GGGTATACTCAGAAGAGGAGAGG - Intergenic
1071365261 10:84892926-84892948 GGGTTTCAGCAGTTGAGGAGAGG - Intergenic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1072776232 10:98197221-98197243 TGGTATCAGCAGAATAGGAAGGG - Intronic
1073055798 10:100700443-100700465 TGGGATTAGCAGAAAAGGAGTGG - Intergenic
1075376387 10:121981130-121981152 AGGTAAAAGCAGGAGAGGAGAGG - Intergenic
1075497105 10:122931702-122931724 CTGTATCAGCTCAAAAGGAGAGG + Exonic
1075659629 10:124184406-124184428 CAGTGTCAGCTGGAGAGGAGCGG + Intergenic
1079669850 11:23154926-23154948 CAGTATCACCAGAAGAGCATGGG - Intergenic
1081601172 11:44495549-44495571 CGAGAATAGCAGAAGAGGAGAGG - Intergenic
1082802673 11:57426167-57426189 CGCCATGAGCAGAAGTGGAGTGG + Exonic
1085345738 11:75767268-75767290 GGGTCACAGCATAAGAGGAGAGG - Intronic
1087510044 11:99080517-99080539 TCCTATCAGCAGAAGAGAAGGGG + Intronic
1088236641 11:107732156-107732178 CGCTATCAGGAGAACAGGATGGG - Intergenic
1091369173 11:135044443-135044465 CGGGGTCAGGAGAAGAGGACAGG + Intergenic
1093272722 12:17084166-17084188 CTCTTTCAGCAGAAGAGGAATGG - Intergenic
1093489583 12:19689501-19689523 AGGTATCAGCAGGGCAGGAGAGG - Intronic
1095732493 12:45521187-45521209 CCCTTTCAGCAGAAGAGGGGTGG + Intergenic
1096818146 12:54214774-54214796 AGGCTTCAGCAGAAGAGGCGTGG + Intergenic
1097314961 12:58162032-58162054 AGGTATCTGCAGAAAAGGAGAGG - Intergenic
1097937131 12:65265355-65265377 AGGTATGAGCAGGACAGGAGAGG + Intergenic
1098874319 12:75851084-75851106 CAGTATCAGCCAGAGAGGAGAGG - Intergenic
1099260955 12:80382309-80382331 CTGCATGAGCAGAAGTGGAGTGG - Intergenic
1100416664 12:94385112-94385134 GGGTATCAACAGAAGTAGAGTGG - Intronic
1101894463 12:108745602-108745624 AGGTATCAGCAGAGCAGGTGGGG - Intergenic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1102892213 12:116568697-116568719 CTTTATGAGCAGAGGAGGAGAGG + Intergenic
1103849462 12:123922491-123922513 GTGTCTCAGCAGAAGAGGACTGG - Intronic
1104068749 12:125327168-125327190 GGGTGTCAGCAGAAGAGAGGTGG - Intronic
1104100055 12:125599162-125599184 CAGTATCACCAGAAGAGCATGGG - Intronic
1104253391 12:127117840-127117862 TGGTATCATCAGAAGAGGAAAGG + Intergenic
1104313936 12:127679662-127679684 AGGGATCAGCAGGAAAGGAGAGG - Intergenic
1104500196 12:129278015-129278037 AGGAATCAGCAGAAAAGGACTGG + Intronic
1105623015 13:22087423-22087445 GGCTGTCAGCGGAAGAGGAGAGG - Intergenic
1106503001 13:30347223-30347245 AGGTATCAGGTGAAGTGGAGTGG + Intergenic
1106518961 13:30480071-30480093 GGGTTTTAGCAGCAGAGGAGGGG - Intronic
1113504775 13:110807830-110807852 CTTTAGTAGCAGAAGAGGAGGGG - Intergenic
1119357415 14:74018936-74018958 CGGGAGCGGCAGAAGCGGAGCGG + Intronic
1120876084 14:89377203-89377225 CGGTGTCATCAGAGGGGGAGAGG + Intronic
1121527464 14:94629009-94629031 ATGTACCAGCAGAAAAGGAGAGG + Intergenic
1124997524 15:34738026-34738048 AGGTATAAGGAGAAGAGTAGTGG - Intergenic
1125160463 15:36637559-36637581 CAGTATCTGCTGAAGTGGAGAGG + Intronic
1126481563 15:49128029-49128051 CTGGATCATCAGAAGAGGGGTGG - Exonic
1127436364 15:58962330-58962352 CTGTACCAGCAGGACAGGAGAGG + Intronic
1128545298 15:68562329-68562351 CAGTCTCAGGAGAAGAGGAAGGG - Intergenic
1128761970 15:70223265-70223287 GGGTGGGAGCAGAAGAGGAGGGG - Intergenic
1129385938 15:75196125-75196147 GGGTGTGAGGAGAAGAGGAGGGG - Intronic
1131504580 15:93005313-93005335 AGGTAACAGGAGAAGAGGGGAGG + Intronic
1132648171 16:1008554-1008576 CCGTATAAGGAGGAGAGGAGAGG - Intergenic
1132955611 16:2591706-2591728 CCTTATCAGCCGAACAGGAGAGG + Intronic
1134989490 16:18686493-18686515 TGGTGTCAGCAGAAGGGGTGAGG - Intergenic
1136401769 16:30023207-30023229 CACTCTCATCAGAAGAGGAGAGG - Intronic
1136747394 16:32603358-32603380 AGGAATCATCAGAAAAGGAGAGG - Intergenic
1137399549 16:48142152-48142174 GGGAAAAAGCAGAAGAGGAGAGG + Intronic
1138331098 16:56216044-56216066 AGGTTTCAGCAATAGAGGAGTGG + Intronic
1139323423 16:66133689-66133711 GGGTTTCAGCAGTAGAGGAATGG - Intergenic
1140123521 16:72102765-72102787 CAGAGTGAGCAGAAGAGGAGTGG - Intronic
1140855564 16:78975000-78975022 CGGTCTCACCAGGAGAGAAGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141572484 16:84942296-84942318 TGGGGTCAGCAGGAGAGGAGAGG - Intergenic
1141972525 16:87493009-87493031 CGGGATCAGCAGAAGTGGGCGGG + Intergenic
1203049530 16_KI270728v1_random:862564-862586 AGGAATCATCAGAAAAGGAGAGG - Intergenic
1146631224 17:34471125-34471147 CAGTGTCAGAAGAAGAGAAGAGG - Intergenic
1147150530 17:38511185-38511207 GGTGATGAGCAGAAGAGGAGGGG + Exonic
1147186834 17:38717580-38717602 AGATAGAAGCAGAAGAGGAGGGG - Exonic
1149080596 17:52651844-52651866 GGGATTCAGCAGAAGAGGAAGGG + Intergenic
1150337662 17:64342330-64342352 CGGTGGCAGGGGAAGAGGAGTGG - Intronic
1150907005 17:69348519-69348541 TGATATGAGCAGAGGAGGAGAGG + Intergenic
1151785036 17:76271338-76271360 CGGTCTCCTCAGAAGAGGGGTGG + Intergenic
1152769681 17:82159540-82159562 AGGCATCAGCAGAAAATGAGAGG + Intronic
1154129891 18:11727520-11727542 CGGTTTAGGCAGAAGATGAGGGG - Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1157713552 18:49866510-49866532 TGGTTGCAGCAGATGAGGAGCGG - Intronic
1158733551 18:60053892-60053914 CGGTATCAGCTGAGATGGAGCGG - Intergenic
1160717885 19:584627-584649 CGGTCTCAGCCGAGGAGGAGGGG - Intergenic
1161503630 19:4632088-4632110 CGCTATCAGGAGAAGAGCATGGG + Intergenic
1162021471 19:7870271-7870293 CGGGACCTGCAGAGGAGGAGCGG + Exonic
1162549730 19:11351728-11351750 GGGGATCAGAAGGAGAGGAGGGG + Intronic
1165428047 19:35756400-35756422 CGATATCTCCAGAAGAGGAGGGG - Intronic
1167375227 19:49107635-49107657 CGGTGGTACCAGAAGAGGAGGGG + Exonic
928854892 2:35791258-35791280 AGGTATGAGCAGAGCAGGAGAGG + Intergenic
930748229 2:54906530-54906552 GGGAATGAGCAGGAGAGGAGTGG + Intronic
932061461 2:68503983-68504005 CAGTATCAACAGTAGAAGAGGGG + Intronic
932212573 2:69944805-69944827 GAGGATCAGCAGTAGAGGAGGGG - Intergenic
932670810 2:73736854-73736876 CGGCGGTAGCAGAAGAGGAGAGG - Intronic
937714575 2:125016762-125016784 AGGTATGAGCAGGGGAGGAGAGG + Intergenic
940772188 2:157851216-157851238 GGGTATAAGCAGACAAGGAGAGG + Intronic
943276764 2:185876981-185877003 CGGTGTCTGCAGCGGAGGAGGGG - Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
947205938 2:227661220-227661242 CGCAGTCAGCAGGAGAGGAGGGG - Intergenic
1171880157 20:30612737-30612759 AGGAAACACCAGAAGAGGAGTGG + Intergenic
1172772280 20:37388786-37388808 TGGTATTAGTAGAAGAGGAGAGG + Intronic
1175036622 20:56005843-56005865 TGGTAGCTGCAGAAGAGGAAGGG - Intergenic
1175945797 20:62558134-62558156 CGGTGACTGCAGCAGAGGAGTGG + Intronic
1177641368 21:23848058-23848080 CGCTATCAGGAGAATAGCAGGGG - Intergenic
1182355572 22:29720987-29721009 GGGCAGCAGCAGAAGGGGAGAGG + Intronic
1182554576 22:31122387-31122409 AGGTGTCTGCAGAAGAGGAGGGG + Intergenic
1183475924 22:38035727-38035749 TGGGAACAGCAGAAGAGGAGGGG + Intronic
1183480145 22:38059291-38059313 CGGGATCAGCATTGGAGGAGGGG + Exonic
1183661072 22:39221597-39221619 TGGTGTCAGCAGAGGAGGAAAGG + Intergenic
1184265956 22:43346132-43346154 GGGTATGGGCAGAAGAGGAGGGG - Intergenic
1184596445 22:45516978-45517000 CGTTCTCAGCAGGGGAGGAGGGG - Intronic
1185294788 22:50047711-50047733 CTCTATCAGCAGGGGAGGAGCGG - Intronic
950075672 3:10185170-10185192 CCGAATCAGCAGATGAGGTGGGG - Intronic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
954977651 3:54711774-54711796 TGGTAGCAGCAGATGAGGAAGGG - Intronic
956076112 3:65508077-65508099 CGGTATTATCAGAAAAGTAGTGG + Intronic
956630951 3:71316110-71316132 CTGGATCTGCAGAAGAGAAGGGG - Intronic
960556312 3:119034624-119034646 CGGTCGCAACAGGAGAGGAGCGG + Exonic
961321423 3:126078976-126078998 TTGCATCAGGAGAAGAGGAGGGG - Intronic
965362787 3:167762255-167762277 TGGTATCATGAGGAGAGGAGAGG - Intronic
966036659 3:175425170-175425192 CGGTATCAGTAGAGGAGTAGAGG + Intronic
968522699 4:1041215-1041237 CGGGAGCAGCAGGAGGGGAGCGG - Intergenic
970284773 4:14499269-14499291 CGTTCTTGGCAGAAGAGGAGGGG - Intergenic
970902302 4:21173950-21173972 TGGTATTAGCAGGAAAGGAGTGG - Intronic
974638209 4:64592666-64592688 GGGTAGAAGCAGAAGAGGAGAGG + Intergenic
976221798 4:82762165-82762187 CTGTCTCAAAAGAAGAGGAGAGG + Intronic
977429715 4:96915966-96915988 TGGTATCAGGAGATGAAGAGAGG + Intergenic
980325861 4:131344957-131344979 CAGTGTCAGGAGTAGAGGAGAGG + Intergenic
980991629 4:139743242-139743264 GGATAACAGCAGAACAGGAGGGG + Intronic
982923620 4:161306429-161306451 CAGTATCAGGAGAACAGCAGGGG + Intergenic
983447524 4:167873139-167873161 GTGTCTCAGCAGAAGAGTAGTGG - Intergenic
983941675 4:173539338-173539360 TTGTATCAGCAGAACAGTAGTGG + Intergenic
985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG + Intergenic
988195170 5:27995908-27995930 CGGCCTCAGCAGAAGATGACTGG + Intergenic
991601780 5:68358301-68358323 AGGTATGAGCACAAGAAGAGTGG - Intergenic
992009076 5:72509280-72509302 GGGCATCAGCAGCAGAGGAAAGG + Intergenic
998509009 5:142695965-142695987 AGTTCACAGCAGAAGAGGAGAGG + Intronic
998704941 5:144748194-144748216 CATTTTTAGCAGAAGAGGAGAGG - Intergenic
1004264819 6:14140055-14140077 CCGCATCAACAGAAGAGAAGAGG + Intergenic
1004653477 6:17634840-17634862 CTGTATCAGCAGGGGAGGCGGGG + Intronic
1005363471 6:25054484-25054506 CAGTCTCGGCAGAAGAGAAGTGG + Intergenic
1010575806 6:77528653-77528675 AGGTGTCAGCTGGAGAGGAGAGG + Intergenic
1012367238 6:98456883-98456905 AGGTGGCAGAAGAAGAGGAGGGG - Intergenic
1017346176 6:153384112-153384134 TGGCATAAGCAGAAGAGTAGAGG - Intergenic
1018312253 6:162523090-162523112 AGGTAACAGCAGAAATGGAGAGG - Intronic
1018404999 6:163470916-163470938 TAGTATTAGAAGAAGAGGAGAGG + Intronic
1018818073 6:167350816-167350838 AGGCATAAGCAGAAGAGGAAAGG + Intronic
1020123045 7:5516318-5516340 TGGTGTCAGAAGACGAGGAGAGG - Intergenic
1020497646 7:8876286-8876308 CCCTTTCAGCAGAAGAGGACAGG + Intergenic
1022600592 7:31755348-31755370 CTCTATCAGCTGAAGGGGAGGGG + Intronic
1027223121 7:76226528-76226550 CTGTATCAGCAGAAAGGAAGTGG + Intronic
1027233975 7:76287074-76287096 TGGGAGCAGCAGAAGAGGACTGG - Exonic
1030561669 7:111094697-111094719 CTTTATCAGAAGGAGAGGAGAGG - Intronic
1030719682 7:112855690-112855712 CAGATTTAGCAGAAGAGGAGGGG - Intronic
1031220471 7:118958555-118958577 CAGTATGAGCAGACAAGGAGGGG - Intergenic
1032785239 7:135195129-135195151 TGGCATTAGCAGAAGAGGATGGG - Intronic
1035097498 7:156366990-156367012 CAGCATCCTCAGAAGAGGAGAGG + Intergenic
1037962510 8:23108491-23108513 AGGTATGAGCAGGACAGGAGAGG - Intronic
1038692195 8:29773732-29773754 GGGTCTCAGCACTAGAGGAGAGG + Intergenic
1040783433 8:51138717-51138739 AGGTATAGGCAGAAGAGAAGGGG - Intergenic
1041266581 8:56071541-56071563 GGGTAACAGCAGTAGGGGAGGGG + Intronic
1042328614 8:67554989-67555011 TGCTATCAGCAGAAGAGGGCTGG + Intronic
1042863053 8:73333045-73333067 AGGCATGAGCAGAACAGGAGAGG + Intergenic
1043762222 8:84082143-84082165 GGGTATCAGCAGCGGAGGCGCGG + Intergenic
1043953602 8:86337400-86337422 GGGGAACATCAGAAGAGGAGAGG + Intergenic
1044251441 8:90007498-90007520 ATGTATCAGGTGAAGAGGAGAGG + Intronic
1044870934 8:96619292-96619314 CGATATCCTGAGAAGAGGAGAGG - Intergenic
1045592937 8:103618622-103618644 AGGAATCAGAAGAAGAGGGGTGG - Intronic
1045792759 8:106004346-106004368 AGCTATCAGAAGAAGATGAGGGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1048193530 8:132311952-132311974 CGTTATAAACAGAAGAGGAGAGG + Intronic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1049595871 8:143483120-143483142 CGAAGTCAGCAGAAGAGGAGCGG + Intronic
1049775201 8:144400830-144400852 GGGCTTCAGCAGGAGAGGAGGGG + Intronic
1050425612 9:5509699-5509721 TGGTATCCTCATAAGAGGAGAGG + Intergenic
1050943884 9:11493941-11493963 CAGTATCAGAAGAAGAGATGAGG + Intergenic
1051778410 9:20660990-20661012 AGGAGTCAGCAGAAGAGGGGAGG + Intronic
1059325546 9:113502086-113502108 AGGCATCAGCAGTAGGGGAGAGG - Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060785835 9:126451085-126451107 CTGCATCACCAGAAGAGCAGGGG + Intronic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1185575500 X:1169062-1169084 GGGGATCAGGAGAAGAGGATAGG + Intergenic
1185961804 X:4552777-4552799 CTCTATGAGCAGAAGAGCAGAGG - Intergenic
1187051052 X:15696009-15696031 CGGTGTCAGGAACAGAGGAGGGG - Intronic
1187059805 X:15775550-15775572 CGGTGTCAGGAACAGAGGAGGGG - Intronic
1190138477 X:47818974-47818996 AGATATGAGCAGAAGAGGATAGG + Intergenic
1191891583 X:65948541-65948563 CAGTATCAGAAGAAGAAAAGGGG - Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1199219385 X:145299394-145299416 AGGTATGAGCAGAGCAGGAGAGG - Intergenic
1201344560 Y:12968275-12968297 CACTATCAGCAGAATAGCAGTGG + Intergenic