ID: 901414634

View in Genome Browser
Species Human (GRCh38)
Location 1:9108222-9108244
Sequence GGTTAGTTGCAGAAGATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901414634_901414647 30 Left 901414634 1:9108222-9108244 CCCCCAATCTTCTGCAACTAACC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 901414647 1:9108275-9108297 TCCTCCAGCTCACCGATTCTTGG 0: 1
1: 0
2: 1
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901414634 Original CRISPR GGTTAGTTGCAGAAGATTGG GGG (reversed) Intronic
901414634 1:9108222-9108244 GGTTAGTTGCAGAAGATTGGGGG - Intronic
905000262 1:34662466-34662488 GGTCATTTGGAGAAGATTTGAGG - Intergenic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
907091469 1:51729676-51729698 GGTGAGAGGCAGACGATTGGCGG - Intronic
907616052 1:55927586-55927608 AGGTAGTTGCAGAAGATCAGAGG + Intergenic
909118234 1:71567088-71567110 GGTTTCTTGCAGAAAATTGGAGG + Intronic
909251756 1:73366418-73366440 GATTAGATGCAGAAGCTTGGAGG + Intergenic
909597359 1:77421689-77421711 GGTTAGGAGCAGAAGCTTTGTGG - Intronic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
911722369 1:101205426-101205448 GCTTAGTTACAGATGATTGAGGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
917115096 1:171594968-171594990 GGTTTATTGCAGGGGATTGGGGG + Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920257556 1:204665824-204665846 GTTTAATTGCAGAGGATTTGTGG - Intronic
921451067 1:215306310-215306332 GGTCATTTGGAGAAGATTCGAGG - Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924581664 1:245329311-245329333 TGTTAGTGGCAGATGATGGGCGG - Intronic
1064805095 10:19121500-19121522 AGTTAGTTGGAGAAGGTTGTCGG + Intronic
1073388666 10:103151980-103152002 GGTTAGTTAGAGAAAGTTGGAGG - Intronic
1081119421 11:39247015-39247037 GGTCAGTTTCAGAACTTTGGGGG + Intergenic
1085228274 11:74942292-74942314 GGTCAGTTTCAGAAGAAGGGTGG + Intronic
1086498486 11:87427834-87427856 GGAAAGTTGCAGAAGATGGAGGG + Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1092955830 12:13548849-13548871 GGCTAGTTTCAGATGATCGGAGG - Exonic
1103345700 12:120248676-120248698 GGTTAGTTGCTGATTAGTGGTGG - Intronic
1106396125 13:29382438-29382460 GGTAAGTTGCCTAGGATTGGTGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110704028 13:78584490-78584512 GGTTAGAAGTAGAAGTTTGGTGG + Intergenic
1112284246 13:98089713-98089735 TGTTAGGTGCAGACAATTGGGGG + Intergenic
1115313883 14:32006374-32006396 GGTTTGTTCCAGAAGATGGAAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1118500028 14:66352652-66352674 GGTTGGGAGCAGAAGATTTGTGG + Intergenic
1126087313 15:45022607-45022629 CGTTAGCTGCAGAAGAATTGGGG - Intergenic
1126745808 15:51825448-51825470 GGTTAAATGCAGACGGTTGGGGG + Intergenic
1128787211 15:70406675-70406697 AGTTAGTTGCAGGAGAGGGGTGG - Intergenic
1128916155 15:71564438-71564460 TCTCAGTTGAAGAAGATTGGAGG + Intronic
1131391091 15:92049428-92049450 GGTCAGTTGCAAGAGCTTGGGGG - Intronic
1140727215 16:77824323-77824345 GGGTAGTGGCTGAAGATGGGTGG + Intronic
1142137524 16:88458470-88458492 GGTCAGTTGGAGAAGAAAGGAGG + Intronic
1142680352 17:1544078-1544100 GCTTAGTTGGAGAAGTTTAGTGG - Intronic
1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG + Intronic
1150742168 17:67788076-67788098 GGGCAGTTTCAGAAGAGTGGTGG - Intergenic
1154952553 18:21224462-21224484 GGGTGGTTGCTGAAGGTTGGGGG + Intergenic
1155722061 18:29027759-29027781 GGCCAGTTGAAGAAGAGTGGGGG + Intergenic
1156424658 18:36997487-36997509 TGTTAGTTTCAGAGGTTTGGAGG - Intronic
1158104599 18:53871401-53871423 CATTTGTTGCAGAAGACTGGGGG + Intergenic
1158814897 18:61083932-61083954 GGTTATTTGGAGAAACTTGGTGG + Intergenic
1161717552 19:5885348-5885370 GTATAGTAGCAGAAGACTGGAGG + Intronic
926358745 2:12065441-12065463 GATTAGTTGGAGGAGAGTGGAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
928872916 2:36002149-36002171 GGTTAGCAGCAGAAGATAAGTGG + Intergenic
929970873 2:46574594-46574616 TAAAAGTTGCAGAAGATTGGGGG + Intronic
932440289 2:71730656-71730678 GGTTAGTGGCAGGAGCCTGGTGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
938853094 2:135282268-135282290 GGTGAGCTGCAGAAGCTAGGTGG - Intronic
941908166 2:170737101-170737123 GGTTGGTTGCTGCAGATTGTGGG - Intergenic
943823085 2:192352506-192352528 GGAGAGTTGAATAAGATTGGTGG - Intergenic
944587248 2:201183272-201183294 GTTTACTTCCAGAAGATTGGTGG + Exonic
1169343532 20:4813320-4813342 AGTTGGTGGCAGAAGAGTGGCGG - Intronic
1169762327 20:9109538-9109560 GGTAAGTTGCAGAGGGGTGGTGG - Intronic
1170565060 20:17595256-17595278 TGTTAGTAGTAGTAGATTGGAGG + Intronic
1173001509 20:39109172-39109194 GCTTAGTTCCAGAAGCTTTGGGG - Intergenic
1173132760 20:40410067-40410089 ATTTACTTGGAGAAGATTGGGGG - Intergenic
1175422392 20:58842599-58842621 TGTTAGTCTCAGAAGTTTGGAGG + Intronic
1177001829 21:15622608-15622630 CTTTAGTTGCATAAAATTGGGGG - Intergenic
1181850794 22:25748641-25748663 GGTGAGATGAAGAAGAATGGCGG - Intronic
1182654941 22:31882608-31882630 GATTAGAAGCAGAAAATTGGAGG + Intronic
1182665245 22:31953851-31953873 GGTTTGTAGCAGAAGAGTAGGGG + Intronic
956343905 3:68256746-68256768 GGTAATTGGGAGAAGATTGGAGG + Intronic
958498620 3:94876596-94876618 AGTTAGCTGAAGAATATTGGAGG + Intergenic
962313130 3:134339837-134339859 GGGGAGTTGCAGAAGACTGTTGG - Intergenic
963234375 3:142942196-142942218 GGATAGTTGCAAAAGATTTATGG - Intergenic
964392006 3:156207420-156207442 GGTGAGTTGCAAAAGAGAGGAGG - Intronic
965409525 3:168312767-168312789 GATTAATTGCAGAACACTGGAGG + Intergenic
965703035 3:171477981-171478003 GGTTAGCTGCAGTAGTTTGAAGG - Intergenic
967508301 3:190279363-190279385 AGATAGTGGCAGGAGATTGGAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
972401945 4:38713022-38713044 GGCTAGTTGCTGCAGATTGTGGG + Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
975318358 4:72980882-72980904 GCTTAGTTGTAGAAAATTGATGG - Intergenic
975341425 4:73245545-73245567 AGTTAGTGGGAGAAGATTGTGGG - Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
978036825 4:104005116-104005138 GGTTGTTTCCAGAAGACTGGAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
991178364 5:63718331-63718353 GTTTAGTTGCAGAAAATGGATGG + Intergenic
993735176 5:91467598-91467620 GGTTATTTGCAGGAGAATGTAGG - Intergenic
994682243 5:102902873-102902895 GGTTTGTTTCTGGAGATTGGTGG + Intronic
994739819 5:103603804-103603826 GGCTAGATGCAGATGATTAGTGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995815628 5:116164752-116164774 AGTTAGTTGCAAAATTTTGGGGG + Intronic
996576236 5:124979070-124979092 GGTTAGTTACAGGAGAGTGTCGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999151628 5:149430228-149430250 GGTGAGATGAATAAGATTGGGGG - Intergenic
999298239 5:150474060-150474082 GGCGAGTTGCAGAAGAAGGGAGG + Intergenic
1001649638 5:173306510-173306532 GGGCAGTAGCAGAGGATTGGGGG - Intergenic
1001764369 5:174233688-174233710 GGTGTGTTTCAGAAGATGGGTGG + Intronic
1003978350 6:11365528-11365550 GGTGAATAGCAGAAGAGTGGTGG + Intronic
1005667446 6:28072340-28072362 GGATAGTTTCAGAAGAACGGAGG - Intergenic
1008146672 6:47899800-47899822 GAGTAGTTGCTGAGGATTGGTGG - Intronic
1008332526 6:50261077-50261099 GGTAAGTTGGAGAACACTGGGGG + Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1011118301 6:83921015-83921037 GTATAGTTGTAGAAGTTTGGGGG + Intronic
1013706363 6:112839657-112839679 AGTTACTGGCAGGAGATTGGAGG + Intergenic
1014028896 6:116679265-116679287 TCTTAGTCACAGAAGATTGGAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1037323684 8:17667715-17667737 GGTGACTACCAGAAGATTGGTGG + Intronic
1042211016 8:66380489-66380511 GGAAAGTTGCAGAAAATGGGTGG - Intergenic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046533723 8:115481402-115481424 GTTTTGTTGCAGAAGAGTGGGGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1049381289 8:142317599-142317621 GCCCAGTTGCTGAAGATTGGAGG - Intronic
1054907766 9:70425593-70425615 GGTTGGTTGCAGAGGCTTAGTGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1058707855 9:107652107-107652129 GAATAGCGGCAGAAGATTGGGGG + Intergenic
1059301630 9:113318359-113318381 GGACAGTGGCAGAAGATGGGTGG + Intronic
1060037136 9:120265114-120265136 GGTGAGTGGCAGAGGAGTGGTGG - Intergenic
1060482931 9:124028404-124028426 TGTCAGTTTCAGAAGATGGGTGG + Intronic
1060830059 9:126708158-126708180 GCATAGTTGCAGAAAATTTGGGG - Intergenic
1185997984 X:4974175-4974197 GGTTAGATGCAAAATTTTGGGGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189579136 X:42387319-42387341 TGTTGGATGCAGAAGGTTGGGGG + Intergenic
1192584648 X:72309345-72309367 GGTTAGTTGCAGAGGCTGAGAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1194067719 X:89283565-89283587 GGTTAACTGCAGCACATTGGAGG + Intergenic
1195367531 X:104140474-104140496 GATTAGTTGAAGAAAATAGGTGG - Intronic
1195992780 X:110699143-110699165 GAATAGTTGCAGAAGAATTGGGG - Intronic
1196090120 X:111731590-111731612 TGCTACTTACAGAAGATTGGAGG + Intronic
1196257943 X:113544828-113544850 GGTTGGTTGCAGAAGTGTGGAGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199520525 X:148730247-148730269 GGATTTTTGCAGCAGATTGGAGG + Intronic
1200721868 Y:6617726-6617748 GGTTAACTGCAGCACATTGGAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic