ID: 901415012

View in Genome Browser
Species Human (GRCh38)
Location 1:9110639-9110661
Sequence CAGTCTGCACATGTGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901415012_901415018 -7 Left 901415012 1:9110639-9110661 CCTAGTTCCACATGTGCAGACTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 901415018 1:9110655-9110677 CAGACTGGGAGGCAGGAACAAGG 0: 1
1: 1
2: 0
3: 65
4: 587
901415012_901415019 -4 Left 901415012 1:9110639-9110661 CCTAGTTCCACATGTGCAGACTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 901415019 1:9110658-9110680 ACTGGGAGGCAGGAACAAGGAGG 0: 1
1: 0
2: 2
3: 54
4: 495
901415012_901415023 18 Left 901415012 1:9110639-9110661 CCTAGTTCCACATGTGCAGACTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 901415023 1:9110680-9110702 GAACTGGGCCAAGGTGTCAGAGG 0: 1
1: 0
2: 4
3: 24
4: 197
901415012_901415021 3 Left 901415012 1:9110639-9110661 CCTAGTTCCACATGTGCAGACTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 901415021 1:9110665-9110687 GGCAGGAACAAGGAGGAACTGGG 0: 1
1: 0
2: 3
3: 41
4: 440
901415012_901415020 2 Left 901415012 1:9110639-9110661 CCTAGTTCCACATGTGCAGACTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 901415020 1:9110664-9110686 AGGCAGGAACAAGGAGGAACTGG 0: 1
1: 0
2: 1
3: 78
4: 762
901415012_901415022 9 Left 901415012 1:9110639-9110661 CCTAGTTCCACATGTGCAGACTG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 901415022 1:9110671-9110693 AACAAGGAGGAACTGGGCCAAGG 0: 1
1: 0
2: 2
3: 34
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901415012 Original CRISPR CAGTCTGCACATGTGGAACT AGG (reversed) Intronic
900918783 1:5657784-5657806 CACTCTGCTCATCTGGAAATGGG + Intergenic
901415012 1:9110639-9110661 CAGTCTGCACATGTGGAACTAGG - Intronic
903281001 1:22249954-22249976 CAGTTTCCACATCTGGAAGTTGG + Intergenic
903424559 1:23244290-23244312 CAGTCTCCTCATCTGGAAATTGG + Intergenic
903985557 1:27225197-27225219 GAGTCTGTCCATATGGAACTAGG + Intergenic
904591081 1:31615704-31615726 GAGTGTGCATATGTGGAACTTGG - Intergenic
905061796 1:35146298-35146320 AAGTCTGGACATCTGAAACTTGG - Intergenic
907285604 1:53377559-53377581 CATTCTGCACAGGCGGGACTTGG - Intergenic
907718854 1:56952781-56952803 CAGTCTGCTCATATGCAAATAGG + Intronic
907840934 1:58156940-58156962 CAGTCTCCACATGTGTAAAATGG + Intronic
908045647 1:60165347-60165369 CAGTCAGCACTTGTTGAAATTGG - Intergenic
908122480 1:60999344-60999366 GAGTCTGCCCTGGTGGAACTAGG + Intronic
911973958 1:104467933-104467955 GAGTCTGGACATCTGGAACACGG - Intergenic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
913718353 1:121563275-121563297 CAGTCTGCATCTGTGGGATTTGG - Intergenic
916550336 1:165844074-165844096 CAGTCTTCCCATGTTGAAATTGG - Intronic
918201845 1:182274989-182275011 CATTCTACAGATGAGGAACTGGG + Intergenic
924859338 1:247905190-247905212 GAGTCTGGACATCTGAAACTTGG - Intergenic
924945501 1:248843857-248843879 CAGTCACCACATGTGGCTCTGGG + Intronic
1064113347 10:12557124-12557146 GAGTCTGGACATGCTGAACTTGG + Intronic
1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG + Intergenic
1068834285 10:61535384-61535406 CAGTCTCTAGATGTGGAATTTGG - Intergenic
1070289217 10:75103883-75103905 CAGTCTCCACAGGTGGGAGTGGG - Intronic
1075247427 10:120835746-120835768 CAGTCAGCACATGTGGAGACAGG - Intergenic
1075841394 10:125507602-125507624 AAGTCTGCACATGTGGAAATAGG - Intergenic
1076893325 10:133295908-133295930 AAGTCTGCACAGGTGGCACAAGG + Intronic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1077600278 11:3569846-3569868 CAGTCAGCACGTGTGGAGCAGGG - Intergenic
1077613116 11:3656909-3656931 CATTTTGGACATGTGGAATTTGG + Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1079369306 11:19836850-19836872 CTGTCTGCAAATGAGGAAGTGGG - Intronic
1080555080 11:33408617-33408639 CACTTTGGACATGTGGGACTGGG - Intergenic
1081549591 11:44098922-44098944 CCGTGTGCACCTATGGAACTGGG + Intronic
1083808572 11:65089365-65089387 CAGTCTACAGATGAAGAACTGGG + Intronic
1084933628 11:72575552-72575574 CAGTCTGCCCATCTTGGACTGGG + Intergenic
1085303255 11:75471141-75471163 CAGTCCCCTCATTTGGAACTTGG - Intronic
1086135464 11:83439640-83439662 CAGTCTCCACAGGTGACACTTGG - Intergenic
1089786276 11:120909522-120909544 TATGCAGCACATGTGGAACTTGG + Intronic
1093648301 12:21614444-21614466 AAGTCTACACATTTGAAACTGGG + Intergenic
1094486188 12:30927428-30927450 CAGTGTGCACATGTGTGAATTGG + Intronic
1098063677 12:66589028-66589050 CAGTTTGCTCATGTGTAACAGGG + Intronic
1098639651 12:72824034-72824056 GAGTCTGGACATCTGAAACTTGG - Intergenic
1098748036 12:74264996-74265018 GAGTCTGGACATCTGAAACTTGG + Intergenic
1098984743 12:77000021-77000043 GAGGCAGCACATGTGGAAGTAGG + Intergenic
1102185088 12:110941568-110941590 CAATCTGGAGATGTGGCACTGGG - Intergenic
1102485524 12:113252767-113252789 CAATCTGCTCATGTGGATCAGGG - Intronic
1102741788 12:115213886-115213908 AAGTCTGCAGATGTGGACCTGGG + Intergenic
1103538410 12:121649529-121649551 CAGTCTGTACCTCTGGCACTGGG - Intergenic
1109171223 13:59099379-59099401 AAGTCAGCAAATGTAGAACTTGG + Intergenic
1110035257 13:70674189-70674211 AAGTGAGAACATGTGGAACTTGG - Intergenic
1110653966 13:77975346-77975368 GAGTCTGGACATCTGAAACTTGG - Intergenic
1111973900 13:94945811-94945833 CAGTCTGCACTTGATGAAATGGG - Intergenic
1115201978 14:30863472-30863494 CAGGCTGCAAATGAGGAATTTGG + Intergenic
1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG + Intergenic
1118915239 14:70097327-70097349 CAGTCTGCAGATGTGCTGCTGGG - Intronic
1121414945 14:93773034-93773056 CATTCTACACATTTGGAAATTGG + Intronic
1121827242 14:97020499-97020521 CACTCCTCACATGTGGAGCTGGG + Intergenic
1122027408 14:98887714-98887736 CAGTCTCCTCATGTGTAAATGGG + Intergenic
1122786749 14:104167502-104167524 CAGTCTTCCCATGTGGAGCGCGG - Intronic
1124430087 15:29599580-29599602 CAGTTTCCACATGAGGAAATAGG - Intergenic
1125860269 15:42992623-42992645 TATTCTGCACATGTGCAGCTTGG + Intronic
1127864451 15:63020484-63020506 CAGTTTGCTCATCTGAAACTGGG - Intergenic
1129521176 15:76187226-76187248 ACGTCTGCACATGTGGGCCTGGG + Intronic
1129694070 15:77730747-77730769 CAGTCTCCACATCTGTAACATGG + Intronic
1130894238 15:88158090-88158112 CAGTTTGCTCATCTGGAAGTTGG + Intronic
1131765067 15:95667058-95667080 AAGTCTGCACATTTGGTAATAGG + Intergenic
1132884099 16:2174934-2174956 CAGTCTCCACATGGGAACCTTGG - Intronic
1140555717 16:75918841-75918863 CACTCTGTATATGAGGAACTGGG - Intergenic
1141635082 16:85310264-85310286 CACTTTGCACATCTGGAAATGGG + Intergenic
1144409763 17:14989405-14989427 CAGGCTGAACATGTGGAAATTGG - Intergenic
1144556369 17:16286220-16286242 CAGTGTGCAAAAGTGGGACTCGG + Intronic
1145770966 17:27492799-27492821 CATTTTGTACATGGGGAACTCGG - Intronic
1148702581 17:49598490-49598512 CAGCCAGCACATGCAGAACTGGG + Intergenic
1149022283 17:51982527-51982549 AAGTTTGAACATGTGAAACTGGG - Intronic
1151349210 17:73521728-73521750 CAGTCTGTAAATGTGGAGTTGGG - Intronic
1152797128 17:82314014-82314036 CAGGCTGCCCATGTGAAGCTAGG + Intergenic
1157214361 18:45770461-45770483 CATTCTGCAGATGTGGAAACTGG + Intergenic
1157334557 18:46728571-46728593 CAGTCAGCACATGGGGTCCTGGG - Intronic
1159588954 18:70310665-70310687 CAGTCTCCTCATGTGAAAATGGG - Intronic
1159848962 18:73503097-73503119 TCGTCTGCACACGTAGAACTGGG + Intergenic
1160051635 18:75439363-75439385 CATTCTGCCCCTGTTGAACTAGG + Intergenic
1160391681 18:78538870-78538892 CAGTCTGCACATGTGACAAACGG - Intergenic
1163502462 19:17684813-17684835 GAGTCTGCACATGTGTGTCTAGG + Intronic
1163867376 19:19785531-19785553 GAGTCTGGACATCTGAAACTTGG - Intergenic
1163916414 19:20244429-20244451 GAGTCTGGACATCTGGAACATGG + Intergenic
1163934633 19:20431855-20431877 GAGTCTGGACATCTGTAACTTGG - Intergenic
1164829111 19:31307184-31307206 CAGTCTGCACATATAGAAACGGG - Intronic
1167008363 19:46789615-46789637 CAGTCTTCATATGTGTAAATGGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168385673 19:55961234-55961256 CAATCTTCACATGTGTATCTTGG + Intronic
926592230 2:14751836-14751858 CAGGCTGCACCTGTGGTGCTTGG - Intergenic
927511849 2:23648917-23648939 CAGTTTCCACATCTGTAACTTGG + Intronic
929207821 2:39318153-39318175 CAGTGAGAACATGTGGAATTTGG - Intronic
929830860 2:45345212-45345234 CAGTCTGTTCATCTGTAACTTGG + Intergenic
930462639 2:51702854-51702876 AAGCCTGCATATGTGGAACTGGG + Intergenic
930736773 2:54787668-54787690 CATTTTGCTCATGGGGAACTTGG + Intronic
931500186 2:62856368-62856390 CAGTTTCCACATCTGGCACTGGG - Intronic
931990320 2:67783568-67783590 CATTCTACACATCTGGAATTGGG + Intergenic
937966213 2:127513335-127513357 CAGGCTGCACATGAGGTACGGGG + Intronic
943407820 2:187511194-187511216 CAGTCTGGACATCTGAAACTTGG + Intronic
944013247 2:195000143-195000165 CAGGCTGCAAATGTGAAACACGG + Intergenic
945254384 2:207791706-207791728 TAGTGGGCAGATGTGGAACTGGG - Intergenic
946415116 2:219536355-219536377 CAGTCTACACTTGTGGAGCGTGG + Intronic
946983544 2:225246496-225246518 CAGTGAGAACATGTGGAATTTGG + Intergenic
948037954 2:234874415-234874437 CAGGCTGCACCTCTGGAATTGGG + Intergenic
948081216 2:235206934-235206956 CTGCCTGCACATGTGGTCCTGGG + Intergenic
948795695 2:240401087-240401109 CAGTCTGTAGATGAGGATCTGGG + Intergenic
1168922525 20:1552371-1552393 CACTCGGTACATTTGGAACTGGG + Intronic
1169990991 20:11502284-11502306 TACTTTGCACATGTGTAACTTGG - Intergenic
1171407288 20:24919973-24919995 AAGTCTGGACATCTGAAACTTGG + Intergenic
1174375868 20:50126279-50126301 CAGTGTGCTCATGTGGAAAATGG - Intronic
1177007081 21:15686772-15686794 CAGAATGGACATGTGGAGCTGGG - Intergenic
1177271732 21:18857515-18857537 CAGGAGGCACCTGTGGAACTTGG + Intergenic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1179671146 21:42949574-42949596 GAGTCTGCACATCTGAAACTTGG - Intergenic
1180051686 21:45334610-45334632 CACACTGCACCTGTGGGACTCGG - Intergenic
1180939088 22:19645132-19645154 CAGGCTGCCCATGTGGCCCTTGG - Intergenic
1181989954 22:26829788-26829810 CAGTTTGCACATCTGTAATTCGG + Intergenic
1183713003 22:39517441-39517463 CAGTCAGCAAATGTGGAATATGG - Exonic
952085239 3:29812590-29812612 CAGTCTGCCCATCTAAAACTTGG + Intronic
953818542 3:46183572-46183594 CAGCCTGCACATGTGGAAGTGGG - Intronic
955066782 3:55540273-55540295 CAGAATGCACTTGGGGAACTGGG + Intronic
956071727 3:65460089-65460111 CAGTCTTCACATGGGAAAATAGG - Intronic
959718079 3:109455671-109455693 CAGCCTGCACAAGTTGATCTTGG + Intergenic
962096223 3:132295678-132295700 GAGTCTGGACATCTGAAACTTGG + Intergenic
962933981 3:140062503-140062525 AAGTCTGCTCACATGGAACTGGG - Intronic
967138692 3:186534337-186534359 CAGTTTACAGATGAGGAACTGGG - Intergenic
969646748 4:8434626-8434648 AAGTCTGGACATTTGAAACTTGG + Intronic
969754355 4:9138632-9138654 CAGTTTCCTCATGTGTAACTTGG - Intergenic
969783321 4:9429810-9429832 CAGTCAGTACATGTGGGATTAGG - Intergenic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972274792 4:37546900-37546922 GAGTCTGGACATCTGAAACTAGG + Intronic
974949953 4:68575950-68575972 GAGTCTGGACATCTGGAACTTGG - Intronic
975237125 4:72012269-72012291 AAGTCTGCAAATGAGGAACAGGG - Intergenic
976387226 4:84474978-84475000 GAGTCTGTACACATGGAACTTGG + Intergenic
978084446 4:104633068-104633090 CAGTCTGCAAATGTGTGAGTTGG - Intergenic
979512953 4:121574811-121574833 CAGTCTGCAAATGAGGAAGCAGG + Intergenic
979823104 4:125198529-125198551 CTGTCTGCACATGTGGTATAAGG - Intergenic
980072732 4:128260713-128260735 GAGTCTGGACATCTGAAACTTGG + Intergenic
981604375 4:146526603-146526625 AAGTCTGGACATCTGAAACTTGG + Intergenic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
985798511 5:1984451-1984473 CAGTCAGCAGATGCTGAACTTGG - Intergenic
986207104 5:5635232-5635254 AAGGCTGGGCATGTGGAACTGGG + Intergenic
986599470 5:9457311-9457333 CACTCTGCACAGGTAGAAATTGG - Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
989096350 5:37785433-37785455 GAGTCTGGACATCTGAAACTTGG - Intergenic
989182073 5:38588170-38588192 CAGTCTACTCATCTGCAACTGGG - Intronic
991146150 5:63307243-63307265 CACTCTGCCCTTGTGGAATTGGG + Intergenic
991305776 5:65174542-65174564 GAGTCTGGACATCTGAAACTTGG + Intronic
992495575 5:77290128-77290150 CATTTTCCACACGTGGAACTAGG - Intronic
998521381 5:142804030-142804052 CAGTCTCCTCATGTGGAAAATGG - Intronic
999131888 5:149289896-149289918 CAGTTTCCACATGTGTAAGTGGG + Intronic
1007104749 6:39275883-39275905 CTGTCTGCACTTGTGGAATTAGG + Intergenic
1008122658 6:47635461-47635483 GAGTCTGGACATCTGAAACTTGG + Intergenic
1010355954 6:74933312-74933334 CTGTGTGCACATGTAGAAGTTGG + Intergenic
1011564729 6:88662837-88662859 GAGTCTGGACATCTGGAACATGG + Intronic
1012072889 6:94645330-94645352 CAGTCTCCATATGGGGAACCAGG + Intergenic
1015171618 6:130260854-130260876 GAGTCTGGACATCTGAAACTTGG + Intronic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1019304255 7:325372-325394 CAGTCTCCACATTTGAAAATGGG + Intergenic
1019426592 7:980370-980392 CTGGCTGCTCAAGTGGAACTTGG - Intergenic
1019601210 7:1884699-1884721 CAGTCTTCCCATGTGGGACCAGG - Intronic
1022649133 7:32258890-32258912 CAGTCTTCCCATGTGTGACTTGG + Intronic
1023055348 7:36285941-36285963 CTGTCTGCACATGTACACCTGGG + Intronic
1027580831 7:79993156-79993178 TAGTCTGTAAATATGGAACTAGG + Intergenic
1028221358 7:88200902-88200924 CAGTCTGCTCTTGTGAAAATTGG + Intronic
1028613614 7:92739311-92739333 AAGTTTGCACATCTGGAGCTTGG - Intronic
1029155037 7:98511277-98511299 CCACCTGCACATGTGGAGCTTGG + Intergenic
1030119204 7:106090117-106090139 CAGTTTGCTTATGTGGAAGTCGG - Intergenic
1034334781 7:150314116-150314138 CAGCTTGCTCATGTGGCACTGGG + Intronic
1036372387 8:8172502-8172524 GAGTCTGGACATTTGAAACTTGG + Intergenic
1036480672 8:9136636-9136658 GAGACAACACATGTGGAACTGGG - Exonic
1036817239 8:11911363-11911385 GAGTCTGGACATTTGAAACTTGG - Intergenic
1036878516 8:12493139-12493161 GAGTCTGGACATTTGAAACTTGG - Intergenic
1037149778 8:15622508-15622530 TAGACAGCACAGGTGGAACTGGG - Intronic
1038089375 8:24236202-24236224 GAGTCTGGACATGTGAAACTTGG + Intergenic
1038380821 8:27091686-27091708 CAGTCTGAACATGTGGTTATTGG + Intergenic
1040966425 8:53085706-53085728 CAGTTTGCTCATCTGTAACTTGG + Intergenic
1043424705 8:80136923-80136945 CAGTCATTACCTGTGGAACTAGG - Intronic
1045033380 8:98158322-98158344 GATTCTCCACATGTAGAACTTGG - Exonic
1045327740 8:101129145-101129167 CAGTCTTCTCATGCAGAACTTGG + Intergenic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1047980109 8:130172085-130172107 CAGTTTGCTCATGTGTAAATGGG + Intronic
1048442162 8:134468134-134468156 CAGTCTGCTCATGGGGCACTGGG - Intergenic
1052969005 9:34364962-34364984 CTCTCTGCACATCTGGATCTGGG - Intergenic
1055907975 9:81315896-81315918 GAGTCTGGAAAGGTGGAACTAGG - Intergenic
1057049389 9:91911108-91911130 TAGTGTGCAGATGTGGAAATGGG - Intronic
1061087806 9:128409421-128409443 CAGCCTAGACATCTGGAACTGGG - Intergenic
1061371399 9:130199590-130199612 CAGTTTCCACATTTGGAGCTGGG + Intronic
1061679156 9:132234365-132234387 CGGTCTGCTCCTTTGGAACTGGG - Intronic
1185909216 X:3966560-3966582 GAGTCTGGACATCTGAAACTTGG + Intergenic
1186661603 X:11673088-11673110 CAGTCTCCTCATCTGGAACTTGG + Intergenic
1188075208 X:25767466-25767488 CAGTCAGAACATGTGGTATTTGG + Intergenic
1188462161 X:30440977-30440999 CATTCTGCCCACCTGGAACTGGG + Intergenic
1190269918 X:48854417-48854439 GAGTCTGGACATCTGAAACTTGG + Intergenic
1190512390 X:51186202-51186224 CAGTCAGCACATTTGGAAGTAGG + Intergenic
1191933856 X:66404999-66405021 CATTCTGCACTTGTGGACCATGG - Intergenic
1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG + Intergenic
1193213541 X:78836610-78836632 TAGTATGCATGTGTGGAACTGGG - Intergenic
1194399919 X:93430409-93430431 GAGTCTGGACATTTGAAACTTGG + Intergenic
1197067561 X:122251977-122251999 CAGGCTGGCCAAGTGGAACTAGG + Intergenic
1198469824 X:136935901-136935923 AAGTCTGGACATCTGAAACTTGG - Intergenic
1200984125 Y:9288292-9288314 GAGTCTGGACATCTGGAACATGG - Intergenic
1201260339 Y:12153102-12153124 GAGTCTGGACATCTGAAACTTGG - Intergenic
1201308015 Y:12567740-12567762 GAGTCTGGACATCTGAAACTTGG + Intergenic
1201372757 Y:13283011-13283033 GAGTCTGGACATCTGAAACTTGG + Intronic