ID: 901419067

View in Genome Browser
Species Human (GRCh38)
Location 1:9137967-9137989
Sequence AGAATTCTGCCCATCAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901419067_901419077 16 Left 901419067 1:9137967-9137989 CCGGCCTTGATGGGCAGAATTCT No data
Right 901419077 1:9138006-9138028 CAGCCAAGATTCCTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901419067 Original CRISPR AGAATTCTGCCCATCAAGGC CGG (reversed) Intergenic
No off target data available for this crispr