ID: 901420325

View in Genome Browser
Species Human (GRCh38)
Location 1:9146338-9146360
Sequence CAGGAAGAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901420325_901420332 4 Left 901420325 1:9146338-9146360 CCTTCCTCCTCCTCCTCTTCCTG No data
Right 901420332 1:9146365-9146387 TTCCCCCTACCCTCCCCACACGG No data
901420325_901420337 8 Left 901420325 1:9146338-9146360 CCTTCCTCCTCCTCCTCTTCCTG No data
Right 901420337 1:9146369-9146391 CCCTACCCTCCCCACACGGGAGG No data
901420325_901420342 17 Left 901420325 1:9146338-9146360 CCTTCCTCCTCCTCCTCTTCCTG No data
Right 901420342 1:9146378-9146400 CCCCACACGGGAGGTGTATCAGG No data
901420325_901420333 5 Left 901420325 1:9146338-9146360 CCTTCCTCCTCCTCCTCTTCCTG No data
Right 901420333 1:9146366-9146388 TCCCCCTACCCTCCCCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901420325 Original CRISPR CAGGAAGAGGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr