ID: 901423318

View in Genome Browser
Species Human (GRCh38)
Location 1:9165268-9165290
Sequence TGTCCCCGATGAGGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901423310_901423318 1 Left 901423310 1:9165244-9165266 CCAGTGGAACATGCAGAGGCCAC No data
Right 901423318 1:9165268-9165290 TGTCCCCGATGAGGGCCTGGGGG No data
901423308_901423318 6 Left 901423308 1:9165239-9165261 CCAGACCAGTGGAACATGCAGAG No data
Right 901423318 1:9165268-9165290 TGTCCCCGATGAGGGCCTGGGGG No data
901423307_901423318 10 Left 901423307 1:9165235-9165257 CCTGCCAGACCAGTGGAACATGC No data
Right 901423318 1:9165268-9165290 TGTCCCCGATGAGGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901423318 Original CRISPR TGTCCCCGATGAGGGCCTGG GGG Intergenic