ID: 901423371

View in Genome Browser
Species Human (GRCh38)
Location 1:9165486-9165508
Sequence GCCGCCCAGAAAATACTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901423371_901423375 24 Left 901423371 1:9165486-9165508 CCCTGGAGTATTTTCTGGGCGGC No data
Right 901423375 1:9165533-9165555 AGAAAGCATCTCCAAGAAGTGGG No data
901423371_901423374 23 Left 901423371 1:9165486-9165508 CCCTGGAGTATTTTCTGGGCGGC No data
Right 901423374 1:9165532-9165554 CAGAAAGCATCTCCAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901423371 Original CRISPR GCCGCCCAGAAAATACTCCA GGG (reversed) Intergenic
No off target data available for this crispr