ID: 901426019

View in Genome Browser
Species Human (GRCh38)
Location 1:9182750-9182772
Sequence TCGCCGCGACGCCCAGTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901426012_901426019 9 Left 901426012 1:9182718-9182740 CCGTACAAAAGCAAACAGAAACC No data
Right 901426019 1:9182750-9182772 TCGCCGCGACGCCCAGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901426019 Original CRISPR TCGCCGCGACGCCCAGTCCG AGG Intergenic
No off target data available for this crispr