ID: 901430615

View in Genome Browser
Species Human (GRCh38)
Location 1:9211806-9211828
Sequence CCTCATGTGCTGAGGCTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901430615_901430619 1 Left 901430615 1:9211806-9211828 CCTTCGAGCCTCAGCACATGAGG No data
Right 901430619 1:9211830-9211852 AATTGGTAAACTAACGACCAAGG No data
901430615_901430620 11 Left 901430615 1:9211806-9211828 CCTTCGAGCCTCAGCACATGAGG No data
Right 901430620 1:9211840-9211862 CTAACGACCAAGGAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901430615 Original CRISPR CCTCATGTGCTGAGGCTCGA AGG (reversed) Intergenic
No off target data available for this crispr