ID: 901430727

View in Genome Browser
Species Human (GRCh38)
Location 1:9212876-9212898
Sequence GCAACTGTTAAGGTTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901430727_901430731 1 Left 901430727 1:9212876-9212898 CCATCCTTAACCTTAACAGTTGC No data
Right 901430731 1:9212900-9212922 TCATGAGCCACTGCAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901430727 Original CRISPR GCAACTGTTAAGGTTAAGGA TGG (reversed) Intergenic
No off target data available for this crispr