ID: 901431068

View in Genome Browser
Species Human (GRCh38)
Location 1:9215286-9215308
Sequence CACGCTGGCCATTTTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901431068_901431077 14 Left 901431068 1:9215286-9215308 CCCAGAACAAAATGGCCAGCGTG No data
Right 901431077 1:9215323-9215345 AAGACCTGAAGGTGGAGAGGAGG No data
901431068_901431079 21 Left 901431068 1:9215286-9215308 CCCAGAACAAAATGGCCAGCGTG No data
Right 901431079 1:9215330-9215352 GAAGGTGGAGAGGAGGCGCCTGG No data
901431068_901431072 3 Left 901431068 1:9215286-9215308 CCCAGAACAAAATGGCCAGCGTG No data
Right 901431072 1:9215312-9215334 CTCCCACACGAAAGACCTGAAGG No data
901431068_901431076 11 Left 901431068 1:9215286-9215308 CCCAGAACAAAATGGCCAGCGTG No data
Right 901431076 1:9215320-9215342 CGAAAGACCTGAAGGTGGAGAGG No data
901431068_901431075 6 Left 901431068 1:9215286-9215308 CCCAGAACAAAATGGCCAGCGTG No data
Right 901431075 1:9215315-9215337 CCACACGAAAGACCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901431068 Original CRISPR CACGCTGGCCATTTTGTTCT GGG (reversed) Intergenic
No off target data available for this crispr