ID: 901433832

View in Genome Browser
Species Human (GRCh38)
Location 1:9234585-9234607
Sequence CACGGCCACCAGGGGGCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901433824_901433832 16 Left 901433824 1:9234546-9234568 CCGCGCGCGTCTCGGACGCGGCA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 901433832 1:9234585-9234607 CACGGCCACCAGGGGGCCGAAGG 0: 1
1: 0
2: 1
3: 11
4: 123
901433820_901433832 29 Left 901433820 1:9234533-9234555 CCACTTCTGGGTCCCGCGCGCGT 0: 1
1: 0
2: 0
3: 4
4: 36
Right 901433832 1:9234585-9234607 CACGGCCACCAGGGGGCCGAAGG 0: 1
1: 0
2: 1
3: 11
4: 123
901433823_901433832 17 Left 901433823 1:9234545-9234567 CCCGCGCGCGTCTCGGACGCGGC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 901433832 1:9234585-9234607 CACGGCCACCAGGGGGCCGAAGG 0: 1
1: 0
2: 1
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901433832 Original CRISPR CACGGCCACCAGGGGGCCGA AGG Intergenic
900382572 1:2392072-2392094 CGCGGCCACCCGGGCCCCGACGG - Intronic
901433832 1:9234585-9234607 CACGGCCACCAGGGGGCCGAAGG + Intergenic
902998036 1:20242975-20242997 CACGGCCACCCGCGGGCCCCAGG + Intergenic
903344288 1:22674318-22674340 CACTGCCACCAGGTGGCGGTAGG + Intergenic
903750820 1:25619242-25619264 CCAGGCCACGAGGGGGCCGTGGG + Intronic
907501286 1:54883435-54883457 CACAGCCACCAGGGGAGAGATGG - Intronic
907515891 1:54993268-54993290 CACTGCCAGCAGGGGTCCAAAGG + Intergenic
918046614 1:180945371-180945393 CACCTCCACCAGGCGGCCCACGG - Exonic
921263271 1:213402332-213402354 CACGGCCACTAAGTGGCCAAAGG - Intergenic
924653264 1:245949312-245949334 CACCGCCACCGTGGGGCCCAAGG + Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1067817549 10:49493765-49493787 CATGGCTACCAGGGGACAGAGGG + Intronic
1068956008 10:62818920-62818942 CCCGGCCAGCAGGGCGCGGAGGG + Intronic
1069683313 10:70300454-70300476 CATGGCCTCCTGGGGGCAGAAGG - Exonic
1072620313 10:97075126-97075148 CTCGGGCTGCAGGGGGCCGAGGG - Intronic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1076744697 10:132507037-132507059 CGCGGCCGCCAAGGGGCCCATGG + Intergenic
1080647007 11:34194689-34194711 CCAGGCCACCAGGGCGCCGTCGG + Intronic
1082076922 11:47981435-47981457 CCCGGCCTGCAGGGGCCCGAGGG + Intronic
1083363575 11:62128152-62128174 CAGAGCCACCATGGGGACGACGG + Exonic
1084220389 11:67674296-67674318 CAAGCCCACCAAGGGGCCTATGG - Intronic
1088920022 11:114253916-114253938 AAAGGCAGCCAGGGGGCCGAAGG - Intergenic
1089525684 11:119095010-119095032 CAGCGCCACCGTGGGGCCGAAGG - Exonic
1091718529 12:2795879-2795901 CCCGGCCTCCCCGGGGCCGAGGG - Intronic
1094855953 12:34402908-34402930 CACGGCCACGGAGGGGCCCACGG + Intergenic
1095951749 12:47785400-47785422 CACGGCCTCCAGAGAGCGGATGG + Exonic
1095977551 12:47950061-47950083 CACGCCGAGCAGGGGGCCGGAGG + Intergenic
1096491333 12:52014784-52014806 CACGGCGAGCAGAGGCCCGAAGG - Exonic
1096639230 12:52980987-52981009 GAAGGCCACCAGGGGGCAGAGGG - Intergenic
1096815872 12:54201485-54201507 CACGGCCACAAGGGGGCTCCAGG - Intergenic
1102661515 12:114532777-114532799 CACTGGCACCCGGGGGTCGAGGG + Intergenic
1106335388 13:28778494-28778516 CACGGTCACCAGGCTGCGGACGG + Intergenic
1107939491 13:45371447-45371469 CAAGGCGACTAGGGAGCCGAAGG + Intergenic
1113710993 13:112465432-112465454 CACAGCCACCAGGTGGGCGTGGG + Intergenic
1113750051 13:112770687-112770709 CACGCCCACCAGAGGGGCCAGGG + Intronic
1114610064 14:24034247-24034269 CACGGCCACTGAGGGGCTGAGGG - Intergenic
1119724571 14:76914185-76914207 CACGGCCACCAGGGAGACTTTGG + Intergenic
1122626401 14:103087453-103087475 CAGGGCCACCGGGGCGCTGAGGG + Intergenic
1122844752 14:104486763-104486785 CACGCCCGCCATGGGGCTGAGGG + Intronic
1202947487 14_KI270726v1_random:41958-41980 CACGGCCAGCAGGGGGCGCGCGG + Intergenic
1132567099 16:628589-628611 CACGTCCACCTGGGGGCCTCGGG + Exonic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132744466 16:1430934-1430956 CCCGGCAACCAGGGCCCCGAGGG - Intergenic
1133774574 16:8886711-8886733 CACGGTCAGGAGGGGGACGACGG + Intergenic
1138561047 16:57801393-57801415 CAGGGGCACCAGGGAGCAGAGGG - Intronic
1142709709 17:1716325-1716347 CCCGCCCACCCGGGGGCCGACGG + Intergenic
1149655648 17:58308484-58308506 CAGGGCCACCAGGTGGCAGCAGG + Intronic
1150692334 17:67377366-67377388 CACGGCGCCCGGGGAGCCGAGGG + Intronic
1152751091 17:82062744-82062766 CACTGCCCCCATGAGGCCGACGG + Intronic
1153805295 18:8705274-8705296 CACGGGCAGCAGCGGGCCGGCGG + Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1160136284 18:76274340-76274362 CAGGGCAACCAGGGGGCTGAGGG + Intergenic
1160154375 18:76422333-76422355 CACGGTCTCCAGGGGCCTGACGG + Intronic
1160879741 19:1313991-1314013 CACGGCCACCGGGGAGCGCAGGG - Intergenic
1161741954 19:6026762-6026784 CCCTGCCACCAGGAGGCCGTAGG + Intronic
1161777465 19:6271434-6271456 ACCGGTCACCAGGGGGCCGCAGG - Intronic
1162573212 19:11484133-11484155 CACGGACACCTGGGGGCGGTGGG + Exonic
1162723582 19:12676512-12676534 CATGGCCACCAGGGGGAGCATGG + Intronic
1164468630 19:28509738-28509760 CTCAGGCACCAGGGGGCCTAAGG + Intergenic
1164669630 19:30065063-30065085 CATGCCCTCCAGGGGGCCGTGGG + Intergenic
1164873896 19:31669614-31669636 TTCGGCCACCAGGGGCCCAATGG + Intergenic
929049069 2:37819238-37819260 CAAGGCCACCAGAGGGGTGATGG - Intergenic
932697426 2:73968490-73968512 CAGGGCCCCCGGGGGGCCAAAGG - Intergenic
933244099 2:79955809-79955831 CTCGGCCCCCAGGGGACCTATGG + Intronic
935380543 2:102447097-102447119 CACGGCCACCAGGGTCCCGATGG - Exonic
936089297 2:109490690-109490712 CACGGCCACCTGGGGGTCGTGGG - Exonic
936532053 2:113283256-113283278 CACTGCCACCAGGAGGCCCCAGG - Intergenic
942891250 2:180991558-180991580 CCTGGCCACCAGGTGGCCCAAGG - Intronic
946024141 2:216661719-216661741 CACAGCCAGCAGGGGGCACAGGG - Intronic
946229348 2:218282063-218282085 CATAGCCCCCAGGGGGCGGAGGG + Exonic
946420175 2:219560550-219560572 CCCAGCCACCAGGGGGCCAGAGG - Intronic
947149347 2:227098779-227098801 CAGGCCCACCAGGGGACCCAGGG - Exonic
948699178 2:239749743-239749765 CATGGCCTCCTGGGGGCCGCTGG + Intergenic
948987677 2:241535145-241535167 CCCGGGCACCAGGAGGCCCAGGG + Intergenic
1171408915 20:24933296-24933318 CAAGGGCACCAGGGGGCCACAGG - Intergenic
1171823144 20:29873972-29873994 CACCGCCACCCCGGGGCCGCTGG - Intergenic
1171896960 20:30816339-30816361 CACCGCCACCCCGGGGCCGCGGG + Intergenic
1172655071 20:36531862-36531884 CACTGCCACCAGGAGCCTGAGGG + Intergenic
1172777599 20:37416501-37416523 GAAGGCCACCAGAGGGGCGAGGG - Intergenic
1173256348 20:41396377-41396399 CACAGCCAGCAGGGGCCTGATGG + Intergenic
1174175864 20:48644592-48644614 CACGCCCACCTGAGGGCCCAGGG - Intronic
1179614700 21:42574824-42574846 CCCAGCCAGCAGGGGGCCCAGGG - Exonic
1179904577 21:44415787-44415809 CACGTCCACCAGGGGCCGGATGG - Intronic
1180161052 21:45998912-45998934 CCCGGCCTCAAGGGGGACGAGGG + Exonic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1183030876 22:35103784-35103806 CAAGGTCACCAGGAGGTCGATGG + Intergenic
1185404962 22:50642515-50642537 GAAGGCCACCAGGGGGCCTAAGG - Intergenic
950765176 3:15268110-15268132 CACGCCCACTAGGGGGCAGGAGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
960110282 3:113838749-113838771 CACGGCCGCCAGAGGGCGCAAGG + Exonic
960611595 3:119559777-119559799 CACGAGCACCAGGCGGCCTAGGG + Intergenic
961555549 3:127694563-127694585 CATGGCCACCAGAGGGCTCAGGG - Intronic
965099974 3:164283946-164283968 CACGGCCACGAAGGGGACGTTGG + Intergenic
966378875 3:179323500-179323522 CAACGGCAGCAGGGGGCCGAGGG - Intronic
968480977 4:832903-832925 CAAGGACCCCTGGGGGCCGAAGG + Intergenic
968910747 4:3475952-3475974 CACAGCCACGAGGGGGCCTGGGG - Intronic
969224336 4:5785009-5785031 CACAGCCTCTAGAGGGCCGAAGG - Intronic
969537122 4:7763287-7763309 CACGCCCACCAGGAGGGCCAGGG - Exonic
973714500 4:53662016-53662038 CAGGGCCTCCAGGGGGCCTGGGG - Intronic
991368512 5:65894230-65894252 CTCAGCCACCTGGGGGCCTAAGG - Intergenic
997302143 5:132813896-132813918 CGCTGCCCCCGGGGGGCCGAAGG - Exonic
998957698 5:147454031-147454053 CACAGCCACCAGGGGGCGCGAGG + Intronic
1002536016 5:179875963-179875985 CAGGGCCACCAGGAGCCAGAAGG + Exonic
1002664123 5:180810294-180810316 CACCGCCACCACGGGAGCGAGGG + Intronic
1005989266 6:30893109-30893131 GGCGGCCACCAGGGGGCTGGCGG - Exonic
1006024266 6:31137601-31137623 GCCGGCCACCAGGTGGCAGAAGG + Exonic
1006285583 6:33091830-33091852 CAGGCCCACCAGCAGGCCGAGGG + Intergenic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1007760434 6:44130137-44130159 CACTTCCACCAGGGAGCCGGAGG - Intronic
1015894817 6:138007105-138007127 CTCTGCCACGAGGGGGCAGAAGG - Intergenic
1015965385 6:138692393-138692415 CAGGGCCGCCAGGGGGCGGGCGG + Intronic
1016369927 6:143362797-143362819 CACTGCCACGAGGGGCCCGTGGG - Intergenic
1019771625 7:2886907-2886929 CAAGGCCACCAGGGGGGCCAGGG + Intergenic
1023905147 7:44516667-44516689 CACAGGCACCAGGGGGCCTCTGG - Intronic
1024763411 7:52628321-52628343 CCCAGCCAACAGGGGGCCCATGG + Intergenic
1027202813 7:76073827-76073849 CCAGGCCACCAGGGAGCCGAAGG + Intergenic
1034200737 7:149281685-149281707 CACGGCCACCGGGGGCCAGTGGG + Exonic
1039870066 8:41538786-41538808 CACGTCAACCTGGGGGGCGAAGG - Intronic
1039983770 8:42430222-42430244 CAAGGCTACCAGGGGACCGATGG + Exonic
1049027196 8:140001230-140001252 CACGCACACCAGGGGGGTGAGGG + Intronic
1049415180 8:142491775-142491797 CATGGCCACCTGGGTGCCGGTGG + Intronic
1049716678 8:144096189-144096211 CACGCCCACCAGGTGGCGGTAGG - Exonic
1049961367 9:741404-741426 CACTGCAACCAGGGAGCCGGGGG - Intronic
1054336285 9:63813103-63813125 CACCGCCACCCCGGGGCCGCGGG - Intergenic
1056765701 9:89443330-89443352 CAGGGCCACCAGGATGCCCATGG + Intronic
1057702723 9:97375543-97375565 CACGGCCGCCAGGTGGCCCAGGG - Exonic
1060700804 9:125747547-125747569 CACGGCCACGAAGGGGCGGACGG + Exonic
1060996660 9:127877862-127877884 CACAGCCACCTGGGGGTCCACGG - Intergenic
1061235966 9:129342806-129342828 CACAGCCAGCCGGGGGGCGAGGG - Intergenic
1061368701 9:130186043-130186065 CATGGCCAGCAGGGAGCAGAGGG + Intronic
1062288397 9:135783949-135783971 CACGGCAGCCACGGGGTCGAGGG - Intronic
1062542890 9:137049323-137049345 CATGGCCACCAGGGAGCAGGAGG + Intronic
1203376215 Un_KI270442v1:380521-380543 CACCGCCACCCCGGGGCCGCGGG - Intergenic
1187669630 X:21656377-21656399 CACGGTCACGCGGGGGCCGTCGG - Exonic
1200134984 X:153870429-153870451 CAAGGCCACCAGGTGGCTGCTGG + Exonic
1201065320 Y:10090593-10090615 CACCGCCACCTCGGGGCCAAGGG + Intergenic