ID: 901435487

View in Genome Browser
Species Human (GRCh38)
Location 1:9245021-9245043
Sequence GGTCCCCAGTTGCTCCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901435487_901435489 -3 Left 901435487 1:9245021-9245043 CCTGCTGGGAGCAACTGGGGACC 0: 1
1: 0
2: 2
3: 27
4: 203
Right 901435489 1:9245041-9245063 ACCTGGCTAAGAAGTACTTATGG 0: 1
1: 0
2: 0
3: 5
4: 92
901435487_901435493 22 Left 901435487 1:9245021-9245043 CCTGCTGGGAGCAACTGGGGACC 0: 1
1: 0
2: 2
3: 27
4: 203
Right 901435493 1:9245066-9245088 GGGACTGTTCCAGCTGTACCTGG 0: 1
1: 0
2: 3
3: 6
4: 137
901435487_901435491 1 Left 901435487 1:9245021-9245043 CCTGCTGGGAGCAACTGGGGACC 0: 1
1: 0
2: 2
3: 27
4: 203
Right 901435491 1:9245045-9245067 GGCTAAGAAGTACTTATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 83
901435487_901435492 2 Left 901435487 1:9245021-9245043 CCTGCTGGGAGCAACTGGGGACC 0: 1
1: 0
2: 2
3: 27
4: 203
Right 901435492 1:9245046-9245068 GCTAAGAAGTACTTATGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901435487 Original CRISPR GGTCCCCAGTTGCTCCCAGC AGG (reversed) Exonic
900525496 1:3126444-3126466 GGACCCCAGGTGCTGCCTGCAGG - Intronic
901122642 1:6907825-6907847 GGACCACAGTGGCTCCCAGGTGG - Intronic
901203314 1:7479073-7479095 GGCCTCCAGCTGCACCCAGCTGG + Intronic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
902240310 1:15083954-15083976 GGTCCCCCGATGTTTCCAGCAGG - Intronic
903647019 1:24901984-24902006 GGTCCCAGGGTGGTCCCAGCTGG - Exonic
904261232 1:29288931-29288953 GTGCCCCAGGTGCTCCCAGAGGG + Intronic
905171239 1:36111030-36111052 GCTCCCCAGTTTCTACCAGCTGG - Intronic
905277458 1:36827781-36827803 ATTTCCCAGCTGCTCCCAGCCGG - Intronic
906242805 1:44252316-44252338 GGTGCCGAGCTGCTCCCGGCTGG + Intronic
906880366 1:49582818-49582840 GGTCCCTAGCTGATCCTAGCTGG + Intronic
907357672 1:53889752-53889774 GGGCCTCAGTTGCTCCGCGCCGG + Exonic
907511871 1:54967465-54967487 GGTTCCCACTTGATCACAGCTGG + Intergenic
908663595 1:66464757-66464779 GGACCCCTGTTCCTCCCAACCGG - Intergenic
915355679 1:155254292-155254314 GCTCCCCAGTTGGTGCCAGCCGG - Intronic
916679994 1:167094993-167095015 TGTCCCCAGCCCCTCCCAGCTGG - Intronic
917602419 1:176589966-176589988 GGTCCCCACATGCTCCCAGGAGG - Intronic
921177410 1:212607173-212607195 AGTCCCCAGTTCCCCCCACCGGG - Intronic
924392913 1:243582409-243582431 GGTCCCCAGTCTCTCCTGGCTGG - Intronic
1064655184 10:17549509-17549531 AGTGGCCAGTTGCTCCCAGCAGG + Intergenic
1066678401 10:37912848-37912870 GGTTCCAAGTTGATCCCAGTTGG + Intergenic
1071561787 10:86651179-86651201 GGTCTCCAGGTGCTGGCAGCTGG + Intergenic
1072553384 10:96495806-96495828 GGTCCCCAGCTGCTCCTGCCTGG + Intronic
1076121373 10:127939685-127939707 GGGCCCCAGCTGAGCCCAGCAGG + Intronic
1076275087 10:129191911-129191933 GGGCCTCAGGTGCTCCCAGCTGG + Intergenic
1076504551 10:130963201-130963223 GGTCCCCAGCAGGGCCCAGCAGG + Intergenic
1076680400 10:132168678-132168700 AGTCCCGCGGTGCTCCCAGCTGG - Exonic
1077235488 11:1480177-1480199 GGTCCCCAGTGGGGCCCAGAAGG - Intronic
1077367465 11:2166966-2166988 GGCCTCCAGGTGCTCCCCGCAGG + Exonic
1078049159 11:7946597-7946619 GGTTCCAAGCTGATCCCAGCTGG + Intergenic
1078431393 11:11291169-11291191 AGTCAGCAGTAGCTCCCAGCTGG + Intronic
1082003838 11:47408991-47409013 GGTCCCCAGTGGAGCCCCGCTGG + Intronic
1083733705 11:64667754-64667776 GGTCCCCTGGTGCTCGCTGCTGG - Intronic
1084680404 11:70663278-70663300 GGGCCCCAGGTGCAGCCAGCTGG + Intronic
1085528454 11:77177413-77177435 GGGCCCCATGAGCTCCCAGCTGG - Intronic
1089292129 11:117443755-117443777 GGTGGCCAGTTCCTCACAGCTGG + Intronic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1091917955 12:4282737-4282759 CCTCCCCAGCTCCTCCCAGCAGG + Intronic
1092920753 12:13229726-13229748 TGTCCCCAGTGGCTCACAGTGGG - Intergenic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1097072113 12:56362638-56362660 GCACCCCAGTTGCTCCCACTTGG + Intronic
1097189035 12:57210752-57210774 GGGCCCCAAATGCACCCAGCAGG + Exonic
1097237169 12:57548516-57548538 GGTCCCCAGGGGCTCCAAGGTGG - Intergenic
1100159748 12:91844113-91844135 GATCCCCAGTTTCTCCCATTTGG + Intergenic
1101329864 12:103749003-103749025 GGTGGCCAGATGCTCCCAGAAGG + Exonic
1101841477 12:108330658-108330680 GGTCCCCACTGGATCCCTGCTGG - Intronic
1102588518 12:113940206-113940228 GGTCCCCAGCTGACACCAGCAGG + Intronic
1106521972 13:30506167-30506189 GGTCCCCTGATGCTGCCACCTGG - Intronic
1106591151 13:31099588-31099610 GGACCCCAGTTGCTCCCCAGTGG + Intergenic
1106872028 13:34031838-34031860 GGTTCCCTGTTGCTTCCAGCAGG - Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113794201 13:113047495-113047517 GGTCCCACAATGCTCCCAGCAGG + Intronic
1113888638 13:113725025-113725047 GAGCCCCAGGTGCTCACAGCAGG + Intronic
1116583438 14:46672407-46672429 GTTTCCCAGATGTTCCCAGCAGG + Intergenic
1117067090 14:52021874-52021896 GGTCACCAGTTTTGCCCAGCTGG - Intronic
1118235734 14:64003756-64003778 GGTCCCCTCCTCCTCCCAGCAGG + Intronic
1119110637 14:71970762-71970784 GTTCCCCATTTACCCCCAGCTGG - Intronic
1119570001 14:75661545-75661567 GGTCCGCAGATGCTCCCCCCGGG - Intronic
1119652224 14:76392099-76392121 GGTCCCCCATGGCTCTCAGCAGG + Intronic
1120719430 14:87874410-87874432 GCTTCCCAGTGTCTCCCAGCGGG - Intronic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1122324677 14:100875170-100875192 GGTCCCCAGAAGCTGTCAGCTGG + Intergenic
1122532055 14:102435139-102435161 CGGACCTAGTTGCTCCCAGCAGG + Exonic
1122784627 14:104157992-104158014 GGTCCCCAGGGGCCCACAGCCGG - Intronic
1122937394 14:104966517-104966539 GGGCCCCTGCTGCTCCCACCTGG + Intronic
1124619722 15:31266816-31266838 GGTCCCCACTTGTTCAGAGCTGG + Intergenic
1125519655 15:40340716-40340738 TGTCCCCAGCTGCCCCCAGAGGG + Intronic
1125855623 15:42946755-42946777 GGACCCCAGTTCCTACCACCAGG + Intronic
1126408617 15:48348966-48348988 GGTCTCCCTTTGCCCCCAGCAGG - Intergenic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1129201946 15:74008086-74008108 CTTCCCCAGCTGATCCCAGCAGG - Intronic
1129740494 15:77987393-77987415 GGTCCCCAGATGGTCACTGCAGG + Intronic
1129845255 15:78765169-78765191 GGTCCCCAGATGGTCACTGCAGG - Intronic
1130256586 15:82328690-82328712 GGTCCCCAGATGGTCACTGCAGG + Intergenic
1130598365 15:85261298-85261320 GGTCCCCAGATGGTCACTGCAGG - Intergenic
1132621135 16:868786-868808 GGGCCCTTTTTGCTCCCAGCAGG + Intronic
1132659131 16:1053815-1053837 GGGCCCCACCTGCACCCAGCAGG + Intergenic
1135524145 16:23200945-23200967 GGCCCCCAGATGCTCTCAGGAGG + Intronic
1137668138 16:50263609-50263631 GGGCCCCATAAGCTCCCAGCAGG + Intronic
1138431728 16:56973182-56973204 TGTACCCAGTTTCCCCCAGCGGG - Intronic
1141393175 16:83681479-83681501 GGGCCGCTGTGGCTCCCAGCAGG - Intronic
1141535612 16:84677749-84677771 GGCCCTCTGTTGGTCCCAGCAGG - Intergenic
1142596949 17:1034544-1034566 CTTCCCCAGTTGCCTCCAGCTGG - Intronic
1144196121 17:12896761-12896783 TCTTCCCAGTTGCTCCAAGCTGG - Intronic
1145783499 17:27579185-27579207 GGTACCCAGCGGATCCCAGCAGG - Intronic
1147510990 17:41068764-41068786 GGTCGCCATTTGCACCCAGTTGG + Intergenic
1148564436 17:48625004-48625026 GGTCCCCCGCTGCTCTCTGCGGG - Intronic
1150288282 17:63966288-63966310 GGTCCCTATCTGCCCCCAGCTGG - Intronic
1150461726 17:65359269-65359291 TGTCCCTAGTTGCTGACAGCTGG + Intergenic
1151625709 17:75274289-75274311 GGCCCTCAGTAGCTCTCAGCCGG + Intronic
1152023941 17:77796738-77796760 TGTCCCCAGCTGCCCCCAGCAGG - Intergenic
1152573293 17:81129756-81129778 GGTCCCTGGCAGCTCCCAGCAGG + Intronic
1152961569 18:83322-83344 GGCCCCCACTGGCCCCCAGCAGG + Intergenic
1153624135 18:7007221-7007243 GGTCCCCTGTCACTCCCTGCTGG + Exonic
1153650362 18:7234083-7234105 GGTCTCCAGTTGCTGCTAGAGGG - Intergenic
1155397127 18:25398200-25398222 GAGCCCCAGTTGCTCACAGTGGG + Intergenic
1159881372 18:73861457-73861479 TTCCCCCAGTTGCTCCCAACTGG + Intergenic
1161461102 19:4398180-4398202 AGTCCCCAGTAACACCCAGCAGG - Intronic
1162473868 19:10888297-10888319 GGCCCCCAGTACCTCCCAGCTGG + Intronic
1162965176 19:14152135-14152157 GGTTCCCGGTAGCTCCCTGCAGG + Exonic
1166658602 19:44630185-44630207 TGGCCCCAGTTCCTCCCAGCTGG - Intronic
1166735113 19:45079417-45079439 GGTCCCCAGACGCTCCTATCAGG + Intronic
924988076 2:288766-288788 GGTCCCCAAGGGCTCCGAGCGGG + Intronic
927461050 2:23298437-23298459 GCTCCCCACTTTCTCCCAGATGG + Intergenic
927737543 2:25536047-25536069 GCTCCCCACTTCCTCCCAGACGG + Intronic
931377218 2:61718282-61718304 GGGCCCCAGATGTTCCCATCCGG + Intergenic
934557445 2:95294871-95294893 GGGCCCCAAGTGCTTCCAGCTGG - Intergenic
935729285 2:106051762-106051784 GCTCCCCAGTTGCACACAGAAGG + Intergenic
937217208 2:120320426-120320448 GCTCCCCAGTTGCTTCCAGCAGG + Intergenic
937921485 2:127134804-127134826 GGTCCCCAGTGGCTCCACTCTGG - Intergenic
943503968 2:188730239-188730261 TGTGCCCTGTTGCTCCCACCCGG - Intergenic
945103917 2:206289865-206289887 GGTTCCCAGCTGATCCCAGTTGG + Intronic
945507599 2:210660380-210660402 GGTCCCCAGTTAATAACAGCTGG + Intronic
948109099 2:235440308-235440330 CTTCCCCAGTTTCTCGCAGCAGG + Intergenic
948455433 2:238102436-238102458 GGTCCCGAGATGCCCCCAGGTGG - Intronic
949027857 2:241774732-241774754 GCTCCCCAGCTGCTCCCCACCGG + Intergenic
1169317471 20:4604637-4604659 GGTCCTCACGTGCTCCCAGCCGG + Intergenic
1170018845 20:11813326-11813348 GGTCCCCAATTGATACCAGCAGG - Intergenic
1170064114 20:12292244-12292266 GGCCACCAGTTGCTTCCTGCGGG - Intergenic
1173795173 20:45854947-45854969 GGTACCCAGTGAGTCCCAGCAGG + Intronic
1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG + Intergenic
1176010988 20:62895374-62895396 GGCTCCCATTTGCTCACAGCAGG - Intronic
1176051429 20:63121518-63121540 GGTTTCCAGTTGCTCCCCTCAGG + Intergenic
1178755791 21:35348334-35348356 AGTCCTCAGTTGGGCCCAGCAGG - Intronic
1180177350 21:46097415-46097437 GGTCCCCACCTGAGCCCAGCCGG - Intergenic
1182099213 22:27646054-27646076 CCTCCCTAGTTTCTCCCAGCTGG - Intergenic
1182941026 22:34277618-34277640 GGTCTCTGGTTGCTGCCAGCAGG + Intergenic
1183180750 22:36258115-36258137 GGTCCCCTGTTGATTCCAGGTGG + Intronic
1184273956 22:43399872-43399894 GGTCCCCATGTGGCCCCAGCAGG + Intergenic
1184347796 22:43924091-43924113 CGTCCCCAGACGCACCCAGCGGG - Exonic
1185109347 22:48892393-48892415 TGGCTCCAGTTCCTCCCAGCAGG - Intergenic
949931810 3:9084450-9084472 GTAGCCCAGTTGCTACCAGCAGG + Intronic
949945414 3:9185916-9185938 GTTCCCCAAATGCTCCCAGGAGG + Intronic
950418740 3:12884235-12884257 GGTCTCCAGCAGCTGCCAGCGGG + Intergenic
952993875 3:38857813-38857835 GGACCCCAATTCCTTCCAGCTGG - Intronic
953907844 3:46877214-46877236 GGTACCCAGTGGCTCCTAGACGG - Intronic
953983237 3:47423258-47423280 GATCCCCAGTTTCTACCAGCAGG + Intronic
954134803 3:48577012-48577034 GGTCCCCAGGTTCTCCCTGTGGG + Exonic
954438343 3:50507946-50507968 GGTCCCCAAGGGCCCCCAGCTGG + Intergenic
955637960 3:61050841-61050863 TCTGCCCAGTTTCTCCCAGCTGG - Intronic
956715216 3:72073550-72073572 GGTCCCTACTTGCTGTCAGCTGG + Intergenic
956793012 3:72694457-72694479 GGTCCCCACTTGCTCTCCCCTGG - Intergenic
958256631 3:91332559-91332581 TCTCCCCAGTTTCTCCCATCTGG + Intergenic
959534353 3:107468806-107468828 GAGCCCCAGTTGCTCACAGCAGG - Intergenic
960685032 3:120287087-120287109 GGTTCCCTGTTGCTCCCAGGTGG - Intergenic
960966870 3:123111456-123111478 GGTCCCCCGCTCCTCCCAGGTGG - Intronic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
961572726 3:127811894-127811916 GGTCTTCTGTTGCTCCCAGCTGG - Intronic
961930681 3:130529708-130529730 GGACTACAGGTGCTCCCAGCAGG - Intergenic
963924718 3:150939247-150939269 ACTCCCCAGTTGCTGCCACCAGG - Intronic
966096231 3:176206498-176206520 GGTCCACAGTTGTTCCATGCTGG - Intergenic
966106102 3:176335784-176335806 GTTCCCCAGTTGCTCTCCTCTGG + Intergenic
967574598 3:191076178-191076200 GGCTCCATGTTGCTCCCAGCTGG - Intergenic
968130509 3:196190276-196190298 GGGCCCCCTCTGCTCCCAGCTGG - Intergenic
968234715 3:197024766-197024788 GGTCCACATTTGCTCACATCAGG + Intronic
968875109 4:3262569-3262591 GGTCCCCAGGGGCTTCCAACTGG - Intronic
969596373 4:8151538-8151560 GCTCTCGAGATGCTCCCAGCTGG - Intronic
972360125 4:38319018-38319040 GAGCCCCAGCTCCTCCCAGCCGG + Intergenic
972521307 4:39859823-39859845 TGTCCCCAGTTCATCCCAGGTGG - Intronic
974003055 4:56530368-56530390 AGTCCCCAGATGCGCCCAGAAGG + Intergenic
978248673 4:106604748-106604770 GGTCCACAGTTGCAGCCAGGTGG + Intergenic
978379403 4:108111351-108111373 GGTCCCCAGGTACACTCAGCAGG - Intronic
978409519 4:108411817-108411839 GGTTCCCAGCTGATCCCAGTTGG - Intergenic
981288441 4:143046657-143046679 GCTCCCTAGATTCTCCCAGCAGG + Intergenic
983656572 4:170090298-170090320 GCTCCCGAGCTGCGCCCAGCCGG + Intronic
985051418 4:185995901-185995923 CATCCCCACTTGCTCCCAGCAGG + Intergenic
985553936 5:546995-547017 GGTCTCCAGGTGCACCCTGCAGG + Intergenic
986999783 5:13648457-13648479 GCTCCCCAGATGACCCCAGCAGG - Intergenic
987026990 5:13937381-13937403 GGTACCCAGGTGCTTCCAGCTGG + Intronic
987970598 5:24939056-24939078 TGTCCCCAGTTGCCCTCAGCTGG - Intergenic
995161257 5:108985727-108985749 GGTCCCCAGTTGCATCCAGGTGG + Intronic
995644786 5:114299263-114299285 GGACCTAAGTTGCTCCCAACAGG - Intergenic
997009213 5:129857178-129857200 GTTCCCCACTGGCTCCCAGGAGG + Intergenic
997415772 5:133727460-133727482 GGTCCCCAGGTGTGCCCAGTGGG - Intergenic
997884540 5:137618277-137618299 GCTCCCCATTTGCACCTAGCTGG - Exonic
999979413 5:156943703-156943725 GGCCCCCAGTTTCTCCCAAAAGG - Intronic
1001939285 5:175729303-175729325 GATCCCCTGCTGCTCCCTGCAGG + Intergenic
1003816825 6:9851157-9851179 AGTCCCCACTCTCTCCCAGCTGG - Intronic
1004259352 6:14094887-14094909 ATTCCTCAGTTGCTCCCAGCTGG + Intergenic
1006035402 6:31207607-31207629 GGGCCACTGTTGCACCCAGCTGG - Intergenic
1006296134 6:33170902-33170924 GCTCCCCATCTGCTCCCTGCAGG + Exonic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006900278 6:37495912-37495934 GCTTCTCAGTTGCCCCCAGCGGG - Intronic
1007345729 6:41228314-41228336 GGTTCCCAGTGTCTCTCAGCTGG - Exonic
1008193330 6:48486933-48486955 TGTCCCCAGTTCATCCCAGGTGG - Intergenic
1008376206 6:50794968-50794990 GGACTCCATTTTCTCCCAGCTGG - Intergenic
1008551368 6:52635168-52635190 GGTCCCCAGTTGGTCTTAGCAGG - Intergenic
1008998707 6:57688601-57688623 TCTCCCCAGTTTCTCCCATCTGG - Intergenic
1010193266 6:73214734-73214756 GGCCACCAGTTGGTCCTAGCTGG - Intronic
1011934254 6:92754746-92754768 GGTTCCCAGTTGATCCCAGCTGG + Intergenic
1012006555 6:93720023-93720045 GGTCCCCAGTTGGTCCCATGGGG + Intergenic
1012509680 6:99988822-99988844 GGGCACAAGTTGCTACCAGCAGG + Intronic
1013351466 6:109309785-109309807 GCTCCACTGTTGCTCCCAGGTGG - Intergenic
1017970869 6:159311702-159311724 GGTTCCTAGTGGCACCCAGCAGG + Intergenic
1018915578 6:168130573-168130595 CGTCACCAGATGGTCCCAGCCGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019562272 7:1664961-1664983 GGTCCCCCGTCGCTCCCTGGTGG - Intergenic
1020119645 7:5495821-5495843 GGTTCCCAGACGCTGCCAGCTGG - Intronic
1020257366 7:6509571-6509593 GGTGTTCAGTGGCTCCCAGCTGG - Intronic
1022466670 7:30656719-30656741 GCTCCCCAGCTGCTCCCTGCTGG + Intronic
1023867589 7:44245592-44245614 GGCCCCCAGGTGCTCCCCTCGGG - Intronic
1024554566 7:50592417-50592439 GGTCCCCAAATGTTCCCAGAGGG - Exonic
1024561290 7:50647704-50647726 GGTCCCCAGTTTCTGCCGCCTGG - Intronic
1026130249 7:67614238-67614260 TCTCCCCAGTAACTCCCAGCTGG - Intergenic
1026441702 7:70450633-70450655 GGTACCCAGTGGCTTCCATCTGG - Intronic
1028671667 7:93407704-93407726 GGTCCCAAGCTGATCCCAACTGG + Intergenic
1030105039 7:105979923-105979945 GGTCTCCAGTTGGTTTCAGCAGG + Intronic
1034193136 7:149226002-149226024 GGTCCGGCGTTCCTCCCAGCCGG + Exonic
1037886742 8:22599589-22599611 GGCCCCCAGACACTCCCAGCGGG - Intronic
1043872389 8:85448085-85448107 GGTCGCCAGTTGCTCACAAGAGG - Exonic
1044031749 8:87246952-87246974 TGTCTCCAGTTGCCCCCAGATGG - Intronic
1044954400 8:97464633-97464655 TCTCCCCAGTTGATACCAGCAGG + Intergenic
1049619954 8:143593580-143593602 GGTGCCCAGTTCCTCCCTGCAGG - Intronic
1051770245 9:20569948-20569970 GCTCCTCATTTGCCCCCAGCTGG + Intronic
1056008846 9:82303525-82303547 GGTCCCCAGCTGATCCTGGCTGG + Intergenic
1059284069 9:113157787-113157809 GGTCCCCAATTCTTACCAGCAGG - Exonic
1059338510 9:113583926-113583948 GGTCCCCAGTAGCTGCTAGTAGG - Exonic
1059341611 9:113600631-113600653 TGACCCCAACTGCTCCCAGCAGG - Intergenic
1060471617 9:123952638-123952660 GTTCCCCATTTACTCCCAGGGGG + Intergenic
1062352685 9:136146987-136147009 GGGCCCCACTTCCACCCAGCTGG + Intergenic
1062428252 9:136515941-136515963 CGTCCCCAGTCCCTCCCCGCTGG + Intronic
1062516456 9:136939420-136939442 GGTCCCCAGGGCTTCCCAGCTGG + Intronic
1187133365 X:16524475-16524497 GAGCCCTAGTTCCTCCCAGCTGG + Intergenic
1187735668 X:22301534-22301556 GGCCCCCACTTTCTCCCAGCAGG + Intergenic
1187814366 X:23215082-23215104 GGTCCTCAGTGGATCCCAGTGGG - Intergenic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1192986096 X:76399598-76399620 TGTCCAGAGTTGCTACCAGCTGG + Intergenic
1193739905 X:85204207-85204229 GGCTCCCTGTTGCTCCCAGGTGG + Intergenic
1194412215 X:93571263-93571285 AGTCCCCAGATGCTCCCACAAGG + Intergenic
1195822335 X:108959295-108959317 GGTCCTCAGTTGTTTTCAGCAGG + Intergenic
1196846776 X:119902556-119902578 TGCCCTCAGTTGCTCCTAGCAGG + Intronic
1197767496 X:130068670-130068692 GGTCCCAAGGGGCTCACAGCAGG + Intronic
1200119729 X:153784607-153784629 GGTCCCCAGGTCCTCCAAGAGGG - Intronic