ID: 901436726

View in Genome Browser
Species Human (GRCh38)
Location 1:9251092-9251114
Sequence GCTGGGGTCTCGAAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901436707_901436726 23 Left 901436707 1:9251046-9251068 CCCAGTCCGTGAGCCCCTGAGAG 0: 1
1: 0
2: 1
3: 15
4: 152
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436722_901436726 -9 Left 901436722 1:9251078-9251100 CCCTGGGTACCCTGGCTGGGGTC 0: 1
1: 0
2: 4
3: 54
4: 360
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436708_901436726 22 Left 901436708 1:9251047-9251069 CCAGTCCGTGAGCCCCTGAGAGT 0: 1
1: 0
2: 1
3: 7
4: 121
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436711_901436726 9 Left 901436711 1:9251060-9251082 CCCTGAGAGTCACAGCCCCCCTG 0: 1
1: 0
2: 1
3: 39
4: 283
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436712_901436726 8 Left 901436712 1:9251061-9251083 CCTGAGAGTCACAGCCCCCCTGG 0: 1
1: 1
2: 0
3: 29
4: 219
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436710_901436726 10 Left 901436710 1:9251059-9251081 CCCCTGAGAGTCACAGCCCCCCT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436709_901436726 17 Left 901436709 1:9251052-9251074 CCGTGAGCCCCTGAGAGTCACAG 0: 1
1: 0
2: 0
3: 28
4: 276
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436719_901436726 -7 Left 901436719 1:9251076-9251098 CCCCCTGGGTACCCTGGCTGGGG 0: 1
1: 0
2: 1
3: 29
4: 269
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436721_901436726 -8 Left 901436721 1:9251077-9251099 CCCCTGGGTACCCTGGCTGGGGT 0: 1
1: 0
2: 0
3: 27
4: 316
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436723_901436726 -10 Left 901436723 1:9251079-9251101 CCTGGGTACCCTGGCTGGGGTCT 0: 1
1: 0
2: 3
3: 24
4: 260
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
901436717_901436726 -6 Left 901436717 1:9251075-9251097 CCCCCCTGGGTACCCTGGCTGGG 0: 2
1: 0
2: 2
3: 26
4: 299
Right 901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901436726 Original CRISPR GCTGGGGTCTCGAAGCAGCA TGG Intronic
900563897 1:3323030-3323052 GCTCGGGTGTCGCAGAAGCACGG - Intronic
900579105 1:3399572-3399594 GCTGGGGTTGGGGAGCAGCAGGG + Intronic
900659653 1:3776226-3776248 GCTGGGGGCTCCAGGCCGCAGGG - Intergenic
901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG + Intronic
901747974 1:11387263-11387285 TGTGGGGTCTCAAAACAGCAGGG - Intergenic
903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG + Intergenic
904779793 1:32937180-32937202 GCTGGTGAGTGGAAGCAGCACGG - Exonic
905749228 1:40447635-40447657 GCTGGCGTTTCAAAGCAGCTGGG - Intergenic
906510347 1:46407043-46407065 GCTGGGGTCTGCAGGCAGCGTGG - Intronic
907515053 1:54988515-54988537 GCTGGGCTCTGCAGGCAGCAGGG - Intronic
909218654 1:72925915-72925937 GCTGGCAGCTAGAAGCAGCAGGG - Intergenic
910557038 1:88545568-88545590 GCTGGGCTCTCAATGCAGCTTGG - Intergenic
915019033 1:152762299-152762321 GCTAGGGGCTAGAAGGAGCAAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916963863 1:169915320-169915342 GCGGGGGTCCCGGACCAGCACGG - Intergenic
919916780 1:202144139-202144161 GAGGGGCTCTCGAAGCAGGAGGG - Intronic
920868751 1:209775516-209775538 GCTGGGGACTCCAGGCAGCTTGG + Intronic
921741914 1:218695020-218695042 TCTGGCTTCTGGAAGCAGCACGG + Intergenic
924711757 1:246535260-246535282 ACTGGGGTCTCCAAGCACAATGG - Intergenic
1067084662 10:43231435-43231457 TCTGGGGTCAGGAGGCAGCAGGG - Intronic
1070518088 10:77226461-77226483 GCTGGGATCTCAAACCAGGATGG - Intronic
1070787780 10:79172054-79172076 GCTCAGGTCAGGAAGCAGCAGGG + Intronic
1077456988 11:2687280-2687302 CCTGGGATCTCAAAGCTGCAAGG - Intronic
1080346831 11:31335008-31335030 GGTGGGGTCTAGACACAGCAGGG + Intronic
1084323416 11:68385880-68385902 GCTGGGGACGCTGAGCAGCATGG + Intronic
1085221348 11:74876206-74876228 ACTGGGGTCTCCAAGCACAATGG - Intronic
1091584089 12:1806024-1806046 GCTGGGGTGTGGAGGGAGCAGGG + Intronic
1092524229 12:9299640-9299662 CTTGGGGTCTCCAGGCAGCAGGG + Intergenic
1092543034 12:9432172-9432194 CTTGGGGTCTCCAGGCAGCAGGG - Intergenic
1093420306 12:18967169-18967191 CCTGAGGTCTCCAAGCAGCAAGG - Intergenic
1094509983 12:31090266-31090288 CTTGGGGTCTCCAGGCAGCAGGG + Intronic
1100951925 12:99860360-99860382 GCTGGGGTCATGAAACATCATGG + Intronic
1101830330 12:108251862-108251884 GCTTGGGGCTAGAAGCTGCATGG - Intergenic
1104071743 12:125351866-125351888 GCTGCTGTCATGAAGCAGCAAGG + Intronic
1104977269 12:132557765-132557787 CCTGGGGTCTCCAGTCAGCAGGG + Intronic
1112494242 13:99893240-99893262 TCTGGGGTCTGGAAGCAGTGTGG - Exonic
1112787651 13:102968739-102968761 GCTGGAATATGGAAGCAGCAAGG - Intergenic
1114484643 14:23055595-23055617 GCTGCGGACTCGAAGGAGCTGGG - Exonic
1117090423 14:52244616-52244638 GCTTGGGCCTCGGAGGAGCAGGG + Intergenic
1118087248 14:62431900-62431922 GCTGGGGTAGAGAAGCAGCTTGG - Intergenic
1122277587 14:100603174-100603196 GCTGGGGTGGCGAATCATCAAGG - Intergenic
1122540042 14:102493029-102493051 GATGGGCGCTGGAAGCAGCACGG - Intronic
1122825950 14:104370544-104370566 GCTGGGGCCTGGAGGGAGCAGGG - Intergenic
1123667195 15:22617246-22617268 GCTGGCGTCTCCAAGGAGCTGGG - Intergenic
1124200270 15:27673445-27673467 CCTAGGGTCTGGAAGCAGCGTGG - Intergenic
1124321035 15:28711813-28711835 GCTGGCGTCTCCAAGGAGCTGGG - Intronic
1124481462 15:30083542-30083564 GCTGGCGTCTCCAAGGAGCTGGG + Intronic
1124487917 15:30135638-30135660 GCTGGCGTCTCCAAGGAGCTGGG + Intronic
1124522133 15:30413652-30413674 GCTGGCGTCTCCAAGGAGCTGGG - Intronic
1124536532 15:30552566-30552588 GCTGGCGTCTCCAAGGAGCTGGG + Intronic
1124543006 15:30604615-30604637 GCTGGCGTCTCCAAGGAGCTGGG + Intronic
1124562966 15:30792058-30792080 GCTGGCGTCTCCAAGGAGCTGGG + Intergenic
1124755612 15:32402683-32402705 GCTGGCGTCTCCAAGGAGCTGGG - Intronic
1124762121 15:32455026-32455048 GCTGGCGTCTCCAAGGAGCTGGG - Intronic
1124776509 15:32594042-32594064 GCTGGCGTCTCCAAGGAGCTGGG + Intronic
1125540998 15:40470277-40470299 GCTGGGGGCACAAAACAGCAGGG - Intergenic
1127306081 15:57706855-57706877 GCTTGGGGCTCGAAGCCGCGGGG - Exonic
1128955257 15:71934817-71934839 GATGGGGTCTCTATGAAGCATGG + Intronic
1129253425 15:74320780-74320802 GGTGGGATATCGAAGCGGCAAGG - Intronic
1129254890 15:74328701-74328723 GCAGGGGTCTCCTGGCAGCAGGG - Intronic
1130652750 15:85771605-85771627 GCTTGGGGGTCCAAGCAGCAAGG - Intronic
1132525992 16:414989-415011 GCTGGGATCTGGAGGCAGCAGGG - Intergenic
1132983380 16:2750927-2750949 GCTGGGGTCTTTAACCAGAAAGG + Intergenic
1135099295 16:19592434-19592456 GCTGGGGGCACTAAGCAGCATGG + Intronic
1135343238 16:21666387-21666409 GCTGGGGTGTCCCAGCAGGAGGG + Intergenic
1137575678 16:49598547-49598569 GCTGGGGTCTGTCAGCAGCGAGG - Intronic
1139430659 16:66909429-66909451 GCTGGGGGCTCTGAGCAGCTGGG - Intronic
1142382588 16:89741734-89741756 GCTGGGGACAAGAGGCAGCAAGG - Intronic
1142998807 17:3777554-3777576 GCTGGGGTCTTGGTGCAGAAGGG + Exonic
1143844294 17:9762045-9762067 TCTGGGGTGTCGCAGAAGCATGG + Intergenic
1145281642 17:21472269-21472291 CTTGGGGTCCAGAAGCAGCAAGG - Intergenic
1145395794 17:22493354-22493376 CTTGGGGTCCAGAAGCAGCAAGG + Intergenic
1146508144 17:33423085-33423107 GTTGGGGGCTCGCACCAGCATGG + Intronic
1146563079 17:33888490-33888512 GCTGGGGACTCCCAGCAGCAAGG + Intronic
1147037310 17:37691396-37691418 GCCGGGGTCTCACAACAGCAAGG + Intronic
1147613008 17:41812510-41812532 GCTGGGGTCACGGATGAGCACGG + Exonic
1148108484 17:45131956-45131978 GGTGGGGTCTCCAAGGAGAATGG - Intronic
1148558959 17:48595092-48595114 CCTGGGGTCTCCAAGGAGCAAGG + Intronic
1151523966 17:74651052-74651074 CCTGGGGTCTGGAAGCAGGAGGG + Intergenic
1152339873 17:79718266-79718288 TCTGGGGTCTCCACACAGCAAGG - Intergenic
1152360456 17:79830958-79830980 GCTGGGCTCTAGAATGAGCATGG + Intergenic
1152375032 17:79914547-79914569 CCTGGGTTCTGGAGGCAGCAGGG + Intergenic
1152757822 17:82094300-82094322 GGTGGGGTCTGGCAGCAGGAAGG + Intronic
1152782893 17:82234232-82234254 CCTGGGGTCACTGAGCAGCAGGG - Exonic
1157215724 18:45781877-45781899 ACTGGGGTCTCCATGCAGAATGG + Intergenic
1160509179 18:79443798-79443820 GCTGGGGTCTCTGGGCAGCCTGG - Intronic
1160551340 18:79695484-79695506 GCTGGGGTCACAGAGCAGGAAGG - Intronic
1161444821 19:4312157-4312179 CATGGGGTCTGGAAGCAGCCTGG + Intronic
1162080886 19:8217019-8217041 GCTGGAGTCTGGAAGGAGCTGGG + Intronic
1167693283 19:51000351-51000373 GCTGGGGTTTCGACTCAGGAAGG - Intronic
925069415 2:954783-954805 GATGGGGTGAAGAAGCAGCACGG - Intronic
925470604 2:4157232-4157254 GCTGTGGCCTGGGAGCAGCATGG - Intergenic
927558051 2:24049796-24049818 GCCGGGGTCGGGCAGCAGCAGGG + Exonic
929619430 2:43339787-43339809 GCTGGAATCTGCAAGCAGCAAGG + Intronic
929882299 2:45847638-45847660 CCTGGGGTCTGGACCCAGCAGGG - Intronic
934567875 2:95350584-95350606 GCAGGGGGCCCGGAGCAGCAGGG + Intronic
934843121 2:97644097-97644119 GGTGGGAGCTGGAAGCAGCAAGG + Intergenic
937541114 2:122955373-122955395 GCTGAGGTGTCAAAACAGCAAGG - Intergenic
938378168 2:130822222-130822244 GCTGGGGCCTCAAGTCAGCAGGG + Intergenic
938378184 2:130822306-130822328 GCTGGGGCCTCAAGTCAGCAGGG + Intergenic
938378200 2:130822390-130822412 GCTGGGGCCTCAAGTCAGCAGGG + Intergenic
938378216 2:130822474-130822496 GCTGGGGCCTCAAGTCAGCAGGG + Intergenic
942528729 2:176885362-176885384 GCTGGAGTATGGAAACAGCAAGG - Intergenic
945264955 2:207881840-207881862 GATGGTGCCTCCAAGCAGCAAGG - Intronic
946528555 2:220546734-220546756 GCTGGGGTCTCTGAGCCTCATGG - Intergenic
947573998 2:231258114-231258136 GGTGTGGTCAGGAAGCAGCATGG - Intronic
947765631 2:232635276-232635298 GGTGGGGTCTGGGAGCAGCCCGG - Intronic
948567411 2:238895817-238895839 GCTGGGGGCTCCAAGCAGGAAGG + Intronic
1174146417 20:48455538-48455560 TCTGGGGGCAGGAAGCAGCAGGG + Intergenic
1179915910 21:44478051-44478073 GCTGGAGTCTCCAACCAGCTGGG - Intergenic
1180175947 21:46089506-46089528 GCTGGTGTCTCCAGCCAGCAGGG + Intergenic
1181770069 22:25118844-25118866 CCTGGCGTCTGGAAGGAGCAGGG - Intronic
1181803234 22:25360554-25360576 GCTGGGGACGCTGAGCAGCACGG - Exonic
1182320949 22:29478460-29478482 GCAGGGGTCCCTAAGCAGGAGGG + Intergenic
1183180342 22:36255547-36255569 TCTGGGGACTCCATGCAGCAAGG - Intronic
1183469158 22:37996530-37996552 GCTGGGGCCTTGAGGCAGGAGGG + Intronic
1184092891 22:42301656-42301678 GGAGGGGTCTGGGAGCAGCAAGG + Intronic
1184653988 22:45932082-45932104 GCTGGGGAGATGAAGCAGCAGGG - Intronic
950548859 3:13654686-13654708 GCTGGGGGCTGGGAGCAGGACGG - Intergenic
954760666 3:52871321-52871343 GCTGGGGGCTCGGTGCAGCGGGG + Intronic
955755140 3:62218482-62218504 GCTGAAGTCTCAAAGAAGCAAGG - Intronic
956930893 3:74041645-74041667 ACTTGGGTCTTGAAGCAGAAGGG + Intergenic
957253024 3:77798770-77798792 GCTAAGGCCTCGCAGCAGCAAGG - Intergenic
959907253 3:111723530-111723552 GCTGGCAGCTCCAAGCAGCATGG - Intronic
961037868 3:123655284-123655306 GCTGGAGTCTCAAAGAAACAGGG - Intronic
961371672 3:126435321-126435343 GCCAGGGCCTCGGAGCAGCAGGG + Intronic
966119836 3:176509291-176509313 ACTGGGGTCTCCAAGCACAATGG + Intergenic
966239062 3:177734852-177734874 GTTGGGCTCTCAAAGCAGCTTGG + Intergenic
966462677 3:180194930-180194952 GTTGTGTTCTCGAAGAAGCATGG + Intergenic
967001733 3:185342209-185342231 GCAGGAATCTCGGAGCAGCATGG - Intronic
969477393 4:7429290-7429312 GCTGGGGGCTCACAGCAGCTGGG + Intronic
969493376 4:7512483-7512505 GCTGGGGTGGCCAACCAGCAAGG + Intronic
971256264 4:25016323-25016345 GCAGAGGTCTCGAAACACCAAGG - Intronic
974647569 4:64714880-64714902 GCTGGGGTCTCCAAGCACAATGG + Intergenic
974904535 4:68038556-68038578 GCTTGGGGCTCGAAGCCGCGGGG - Intergenic
976596569 4:86900669-86900691 GCTGGTGAGTCGAAGAAGCAGGG + Intronic
978639354 4:110851223-110851245 GCTGGGGACTCTAAGCTGCAGGG + Intergenic
981542664 4:145861726-145861748 GGAGGGGTCTGGACGCAGCAGGG - Intronic
981545083 4:145885440-145885462 GCTTGGGTCTCAAAACAGTAGGG - Intronic
981992080 4:150933818-150933840 CCTGGGGTCTTGAACCAACATGG + Intronic
985440461 4:189979973-189979995 GCTGGGATATGGAAACAGCATGG - Intergenic
990997869 5:61751320-61751342 GTTGGGGACTCCAAGCAGCAAGG - Intronic
991530034 5:67604906-67604928 GCTGTGGTCTTGATGCAGCAAGG - Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
992676562 5:79111793-79111815 GCTGCGGACTCGGAGCAGCTCGG + Exonic
1001274104 5:170337715-170337737 GCTGTGGTGTAGAAGCAGAATGG - Intergenic
1001525384 5:172425163-172425185 GCTGGAGTCTCGGTGAAGCAGGG - Intronic
1002093724 5:176818816-176818838 GGTGGGGTCAGGAGGCAGCATGG - Intronic
1002574211 5:180162294-180162316 CCTGAGTTCTCAAAGCAGCAGGG + Intronic
1003126602 6:3360967-3360989 GCGGGGAGCTCGAGGCAGCAGGG + Intronic
1003455674 6:6279494-6279516 GCTGGGGTCTGGAAGCCCAAGGG + Intronic
1004429782 6:15533113-15533135 GCTGGGGTCTCATAACAGAACGG + Intronic
1006796042 6:36732928-36732950 GCTGGGGGGTCCAAGCAGCTGGG + Exonic
1006843580 6:37047691-37047713 CCGGGGGTCTAGGAGCAGCAGGG - Intergenic
1010429223 6:75759460-75759482 GCTGCGGTTTTGAAGCAGGAGGG + Intronic
1013115280 6:107098810-107098832 GCAGGGTTCTCTGAGCAGCAGGG + Intronic
1018950658 6:168376875-168376897 GCTGGCGTCGTGAAGCAGCCAGG + Intergenic
1019750993 7:2729651-2729673 GCTCGGGGCTCGGGGCAGCACGG + Exonic
1020465610 7:8475258-8475280 TCTGGGGACACCAAGCAGCAGGG - Intronic
1022098266 7:27154353-27154375 GCTGCGGGCTGTAAGCAGCAGGG + Exonic
1022304002 7:29129186-29129208 GCTGGGGTCAAGGAGTAGCAGGG + Intronic
1023126250 7:36957323-36957345 GCGGTGGTCTGGAAGCAGAAAGG - Intronic
1024915420 7:54493595-54493617 GGTGGGGTTGAGAAGCAGCAAGG + Intergenic
1032387796 7:131536630-131536652 GCTGGGGACAGGAACCAGCAGGG - Intronic
1033096957 7:138440672-138440694 CGTGGGGTCTCGCGGCAGCATGG + Intergenic
1034871893 7:154692562-154692584 GTTGGGGTCAAGAAGCAACAAGG + Intronic
1034935866 7:155200387-155200409 GAAGGGGTCTCCAAGCAGAAAGG + Intergenic
1035340305 7:158156660-158156682 ACTGGGGGCTCGAAGCCCCAGGG - Intronic
1036936683 8:13009243-13009265 GCTGGGGTGTCGAAGCGGGTGGG + Intronic
1038294722 8:26280518-26280540 GAGGGGGTCTAGAAGCAACATGG + Intergenic
1048007485 8:130431218-130431240 GCCAGGGTCTGGAAGCAGGAAGG - Intronic
1049196860 8:141320552-141320574 GATGGGGCCTCGAGGCTGCAGGG - Intergenic
1049233575 8:141496665-141496687 GCAGGGGTCTCGAGGCCTCAAGG + Intergenic
1049288195 8:141787953-141787975 GCTGGGCTCTCGAGGAGGCAGGG - Intergenic
1049651275 8:143771118-143771140 GCTGGGGCCTGGATGCAGGAGGG + Intergenic
1049815794 8:144599024-144599046 CCTGGGGTCTCCATGCAGCCTGG - Intronic
1061411992 9:130426898-130426920 GCTGGGTTCTGGAGGCAGGAAGG - Intronic
1061967815 9:134025858-134025880 GCTGGATGCTCGGAGCAGCAAGG + Intergenic
1062464543 9:136675335-136675357 GCTGGGGACTGGCAGCAGGAAGG + Intronic
1062464573 9:136675417-136675439 GCTGGGGACTGGCAGCAGGAAGG + Intronic
1062561025 9:137141930-137141952 GCTGAGATCTGGAAGCAGCAGGG - Intronic
1190332302 X:49243308-49243330 GGTAGGGACTGGAAGCAGCAGGG - Exonic
1191217824 X:57951694-57951716 GCTGAGTTCACAAAGCAGCAAGG + Intergenic
1193560301 X:83009745-83009767 ACTGGGGTCTCCAAGCACAATGG + Intergenic
1196645792 X:118116599-118116621 GCTGGTGCCTCGCAGCAGGAGGG - Intronic
1198224359 X:134631716-134631738 GCTGGGCTCTGGACTCAGCAGGG + Intronic