ID: 901441957

View in Genome Browser
Species Human (GRCh38)
Location 1:9283387-9283409
Sequence CACCAACTTGCTTTTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901441957_901441965 15 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441965 1:9283425-9283447 AGGAGCATCTCCTTCTGGGTTGG No data
901441957_901441963 10 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441957_901441967 24 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441967 1:9283434-9283456 TCCTTCTGGGTTGGGTGCCAAGG No data
901441957_901441966 16 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441966 1:9283426-9283448 GGAGCATCTCCTTCTGGGTTGGG No data
901441957_901441960 -10 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441960 1:9283400-9283422 CAAGTTGGTGGACAGTGGCTAGG No data
901441957_901441961 -9 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441957_901441964 11 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441964 1:9283421-9283443 GGGCAGGAGCATCTCCTTCTGGG No data
901441957_901441962 -5 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441962 1:9283405-9283427 TGGTGGACAGTGGCTAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901441957 Original CRISPR CACCAACTTGCTTTTCAGAC AGG (reversed) Intergenic
No off target data available for this crispr