ID: 901441961

View in Genome Browser
Species Human (GRCh38)
Location 1:9283401-9283423
Sequence AAGTTGGTGGACAGTGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901441951_901441961 9 Left 901441951 1:9283369-9283391 CCCAGATCCCCACTTGGGCCTGT No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441957_901441961 -9 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441953_901441961 2 Left 901441953 1:9283376-9283398 CCCCACTTGGGCCTGTCTGAAAA No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441947_901441961 14 Left 901441947 1:9283364-9283386 CCCGCCCCAGATCCCCACTTGGG No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441945_901441961 15 Left 901441945 1:9283363-9283385 CCCCGCCCCAGATCCCCACTTGG No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441955_901441961 0 Left 901441955 1:9283378-9283400 CCACTTGGGCCTGTCTGAAAAGC No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441952_901441961 8 Left 901441952 1:9283370-9283392 CCAGATCCCCACTTGGGCCTGTC No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441954_901441961 1 Left 901441954 1:9283377-9283399 CCCACTTGGGCCTGTCTGAAAAG No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441949_901441961 13 Left 901441949 1:9283365-9283387 CCGCCCCAGATCCCCACTTGGGC No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data
901441950_901441961 10 Left 901441950 1:9283368-9283390 CCCCAGATCCCCACTTGGGCCTG No data
Right 901441961 1:9283401-9283423 AAGTTGGTGGACAGTGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901441961 Original CRISPR AAGTTGGTGGACAGTGGCTA GGG Intergenic
No off target data available for this crispr