ID: 901441963

View in Genome Browser
Species Human (GRCh38)
Location 1:9283420-9283442
Sequence AGGGCAGGAGCATCTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901441954_901441963 20 Left 901441954 1:9283377-9283399 CCCACTTGGGCCTGTCTGAAAAG No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441952_901441963 27 Left 901441952 1:9283370-9283392 CCAGATCCCCACTTGGGCCTGTC No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441957_901441963 10 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441951_901441963 28 Left 901441951 1:9283369-9283391 CCCAGATCCCCACTTGGGCCTGT No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441950_901441963 29 Left 901441950 1:9283368-9283390 CCCCAGATCCCCACTTGGGCCTG No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441953_901441963 21 Left 901441953 1:9283376-9283398 CCCCACTTGGGCCTGTCTGAAAA No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data
901441955_901441963 19 Left 901441955 1:9283378-9283400 CCACTTGGGCCTGTCTGAAAAGC No data
Right 901441963 1:9283420-9283442 AGGGCAGGAGCATCTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901441963 Original CRISPR AGGGCAGGAGCATCTCCTTC TGG Intergenic
No off target data available for this crispr