ID: 901441965

View in Genome Browser
Species Human (GRCh38)
Location 1:9283425-9283447
Sequence AGGAGCATCTCCTTCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901441955_901441965 24 Left 901441955 1:9283378-9283400 CCACTTGGGCCTGTCTGAAAAGC No data
Right 901441965 1:9283425-9283447 AGGAGCATCTCCTTCTGGGTTGG No data
901441957_901441965 15 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441965 1:9283425-9283447 AGGAGCATCTCCTTCTGGGTTGG No data
901441953_901441965 26 Left 901441953 1:9283376-9283398 CCCCACTTGGGCCTGTCTGAAAA No data
Right 901441965 1:9283425-9283447 AGGAGCATCTCCTTCTGGGTTGG No data
901441954_901441965 25 Left 901441954 1:9283377-9283399 CCCACTTGGGCCTGTCTGAAAAG No data
Right 901441965 1:9283425-9283447 AGGAGCATCTCCTTCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901441965 Original CRISPR AGGAGCATCTCCTTCTGGGT TGG Intergenic
No off target data available for this crispr