ID: 901441967

View in Genome Browser
Species Human (GRCh38)
Location 1:9283434-9283456
Sequence TCCTTCTGGGTTGGGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901441957_901441967 24 Left 901441957 1:9283387-9283409 CCTGTCTGAAAAGCAAGTTGGTG No data
Right 901441967 1:9283434-9283456 TCCTTCTGGGTTGGGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901441967 Original CRISPR TCCTTCTGGGTTGGGTGCCA AGG Intergenic
No off target data available for this crispr