ID: 901442918

View in Genome Browser
Species Human (GRCh38)
Location 1:9290489-9290511
Sequence TTTCCAGATTAACGCCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901442918 Original CRISPR TTTCCAGATTAACGCCGAAG GGG Intergenic
901442918 1:9290489-9290511 TTTCCAGATTAACGCCGAAGGGG + Intergenic
912304196 1:108548431-108548453 TTTCCAGATTAAATCTGATGTGG - Intergenic
913700726 1:121371965-121371987 TTTCCAGGTTAACTAAGAAGTGG - Intronic
914041276 1:144052427-144052449 TTTCCAGGTTAACTAAGAAGTGG - Intergenic
914136810 1:144908059-144908081 TTTCCAGGTTAACTAAGAAGTGG + Intronic
920488145 1:206390698-206390720 TTTCCAGGTTAACTAAGAAGTGG - Intronic
1066454002 10:35557091-35557113 TTTTCAAATTAAGGCCGAGGTGG - Intronic
1071548451 10:86546861-86546883 TTTCCAGATTAACTGTGCAGTGG - Intergenic
1090475978 11:127020659-127020681 TTTCCAGATTCATGATGAAGAGG - Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1108557641 13:51610857-51610879 ATTCCAGATGAATGCCAAAGAGG - Intronic
1148322002 17:46762458-46762480 TTTCCAGATTAATGCTCAGGAGG - Intergenic
1149051697 17:52312469-52312491 TTTCCAGATTAACACATAACTGG - Intergenic
1153026053 18:673855-673877 TTCACTGATTAACCCCGAAGTGG - Intronic
1153181797 18:2443511-2443533 ATTCAAGCTTAACGCCGAAGAGG + Intergenic
1156393611 18:36676532-36676554 TTTCTAGATAAACGTAGAAGTGG + Intronic
1159010244 18:63052199-63052221 TTTCCAGATAATCCCAGAAGTGG - Intergenic
1160112255 18:76044748-76044770 TGGCCAGATTAACGCCTATGGGG - Intergenic
925345977 2:3172179-3172201 TTTCCAGATTAAAAACGACGAGG - Intergenic
926516583 2:13853806-13853828 TTCCCAGAATAACACAGAAGTGG + Intergenic
933399132 2:81769319-81769341 TTACCAGAATAAGGCCCAAGAGG + Intergenic
941773281 2:169364850-169364872 ATCCCAGAATAACGCAGAAGAGG + Intergenic
1174909533 20:54592373-54592395 CTCCCAGATTAACCCCTAAGAGG - Intronic
960799426 3:121522950-121522972 CTACCAGATTAATGCCAAAGAGG - Intronic
998556545 5:143130431-143130453 TTTCCAAATTAACACAAAAGGGG - Intronic
1047658401 8:127004334-127004356 TTTACAGATTAACGTCGATGAGG - Intergenic
1055971230 9:81915058-81915080 TTTCCAGAGAGAAGCCGAAGAGG + Intergenic
1058683814 9:107463694-107463716 TTTCCAGATGAACCTCAAAGAGG - Intergenic
1059997587 9:119927360-119927382 TTTCTAGATTAACTCTGAAAAGG - Intergenic