ID: 901443513

View in Genome Browser
Species Human (GRCh38)
Location 1:9293249-9293271
Sequence CCCCCGGAGCCACCGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443513_901443529 15 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443513_901443527 9 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443527 1:9293281-9293303 CGCCGCGGCTCCTGGGAGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 179
901443513_901443519 -6 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
901443513_901443525 7 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443525 1:9293279-9293301 CTCGCCGCGGCTCCTGGGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 142
901443513_901443526 8 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443513_901443520 1 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443520 1:9293273-9293295 GCCTCCCTCGCCGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 34
4: 283
901443513_901443522 2 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443513 Original CRISPR CCCCCGGAGCCACCGCGGGA GGG (reversed) Intronic