ID: 901443515

View in Genome Browser
Species Human (GRCh38)
Location 1:9293250-9293272
Sequence GCCCCCGGAGCCACCGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443515_901443526 7 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443515_901443525 6 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443525 1:9293279-9293301 CTCGCCGCGGCTCCTGGGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 142
901443515_901443529 14 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443515_901443519 -7 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
901443515_901443520 0 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443520 1:9293273-9293295 GCCTCCCTCGCCGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 34
4: 283
901443515_901443522 1 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443515_901443527 8 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443527 1:9293281-9293303 CGCCGCGGCTCCTGGGAGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443515 Original CRISPR GCCCCCGGAGCCACCGCGGG AGG (reversed) Intronic