ID: 901443515

View in Genome Browser
Species Human (GRCh38)
Location 1:9293250-9293272
Sequence GCCCCCGGAGCCACCGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443515_901443522 1 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443515_901443519 -7 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
901443515_901443526 7 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443515_901443520 0 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443520 1:9293273-9293295 GCCTCCCTCGCCGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 34
4: 283
901443515_901443527 8 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443527 1:9293281-9293303 CGCCGCGGCTCCTGGGAGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 179
901443515_901443525 6 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443525 1:9293279-9293301 CTCGCCGCGGCTCCTGGGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 142
901443515_901443529 14 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443515 Original CRISPR GCCCCCGGAGCCACCGCGGG AGG (reversed) Intronic
900151185 1:1179993-1180015 GCTCCCGTAGCCACCCCGGTGGG + Intronic
900214161 1:1472207-1472229 GCCCCCGGAGCACCCCCGGCCGG + Intronic
900221710 1:1512591-1512613 GCCCCCGGAGCACCCCCGGCCGG + Intronic
900376450 1:2357034-2357056 GCCCCCAGAGCCATGGCCGGCGG + Intronic
900563132 1:3318020-3318042 GGCCTCGGAGCCGCCGTGGGTGG - Intronic
900581822 1:3413263-3413285 GCCCCTGGAGCCACAGCGGCAGG + Intronic
901443515 1:9293250-9293272 GCCCCCGGAGCCACCGCGGGAGG - Intronic
902361750 1:15945790-15945812 GCCCCGGGAGCCGCCGCCTGTGG - Exonic
903279781 1:22243944-22243966 GCCCCAGGAGCCAGCGAGGGCGG - Intergenic
903650561 1:24919203-24919225 GCCCCCTGAGCCCCTGCGCGGGG - Intronic
904822673 1:33256013-33256035 GCCCCGGGAGCCCCCGCGCTGGG + Intergenic
905791743 1:40793244-40793266 GCTCCCGAGGCCACCGTGGGAGG - Intronic
906128076 1:43439687-43439709 GCCCCCAGACCCACTGCGAGAGG + Exonic
906650284 1:47508174-47508196 GGCCCCGGAGACAGGGCGGGCGG + Intergenic
906678341 1:47708984-47709006 GCCCCGGGAGCCGCAGCAGGCGG - Intergenic
910825596 1:91404425-91404447 GCCCCCTGAGCGAGCGCTGGGGG - Intronic
910936058 1:92485213-92485235 GCCCTAGGAGCCACCCCGGAGGG - Intronic
914213959 1:145607890-145607912 GCCCCTGGGGCCTCCGCGGCGGG + Intergenic
915512567 1:156394377-156394399 GCACCTGGAGCCACAGCCGGAGG + Intergenic
921052249 1:211518913-211518935 GCTCCTGGAGCCACCGTGGCTGG + Intergenic
924853998 1:247857676-247857698 GCGCCCGCAGCCCCCGCCGGGGG - Intronic
1064354884 10:14607408-14607430 ACCCCTGGAGCCACTGTGGGGGG + Intronic
1065102084 10:22340967-22340989 GCCCCGGGAGGCCCCGCGGGAGG + Intergenic
1069633937 10:69913987-69914009 GCCCCAGGAGCCTCCTCGGGAGG - Intronic
1070768626 10:79070072-79070094 TCCCCCGGGGCCACCGCCGCCGG - Intronic
1070835727 10:79445756-79445778 ACCCCCGGAGCCGCCGCTGGAGG - Intergenic
1071598150 10:86942761-86942783 GGCCTCGGAGCCCCCGCGGCCGG - Exonic
1072294180 10:93993826-93993848 GCCGCTAGCGCCACCGCGGGCGG - Intergenic
1073266388 10:102230737-102230759 GCGGCCGGAGCCAGCCCGGGGGG + Exonic
1074065130 10:110007416-110007438 GCCCCAGCAGCCAGCGTGGGCGG + Intronic
1077051312 11:568277-568299 CCCCCCGCAGCCCCCGCGGGAGG + Intergenic
1077058773 11:608695-608717 GCCCCTGGGGCCACAGCCGGAGG + Exonic
1077411606 11:2406368-2406390 GCCCCTGGAGCCAGGGCTGGAGG + Intronic
1079101922 11:17547310-17547332 GCCCGGGGAGGCACCTCGGGAGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1082029373 11:47593753-47593775 AGCCCCGGAGCCAAGGCGGGAGG + Intronic
1083448457 11:62726808-62726830 GCCGCCGGAGCCCCCGGAGGCGG - Exonic
1083658353 11:64241099-64241121 GCCCCCGGAGTCAACCCCGGTGG - Intronic
1083923840 11:65794255-65794277 GCCCTCGGAGACAGCGCGAGTGG - Intronic
1089507276 11:118972094-118972116 GCCCCCCAAGCCTCCCCGGGAGG - Intronic
1090398496 11:126434259-126434281 GCACCAGGAGCCACCGAGGGGGG + Intronic
1091227236 11:133964935-133964957 GGCCCTGGAGCCACAGCTGGAGG + Intergenic
1091616097 12:2052617-2052639 GCCACCGCGGCCACCGCGGCTGG + Intronic
1095983160 12:47984048-47984070 GCCCCCAGGGCCACCTGGGGAGG + Intronic
1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG + Intronic
1099202120 12:79690066-79690088 GTGCCCAGAGCCCCCGCGGGGGG + Exonic
1102047720 12:109840234-109840256 GCCTCAGGACCCACCGAGGGGGG + Intergenic
1102229311 12:111251563-111251585 GCTCCCGGAGATACCGCGAGTGG - Intronic
1104981375 12:132574393-132574415 GCCCCCGGGGCGGCCTCGGGGGG + Exonic
1105040279 12:132956032-132956054 GCCCCCAGAGCCCCCGCCTGAGG + Intronic
1105278923 13:18951995-18952017 GCCCCTGGAGCCAACGGGGCTGG + Intergenic
1105472092 13:20703790-20703812 GGCCCCGGGGACCCCGCGGGCGG + Intronic
1106246388 13:27953896-27953918 GCAGCCGGAGCCGCCGCAGGAGG - Intergenic
1112091888 13:96091093-96091115 GCCCCCCGAGGGACCTCGGGGGG + Exonic
1113894053 13:113752347-113752369 GGCCACGGAGCCAGCGCGGCCGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1114266313 14:21074575-21074597 GCCACCGGAGACACCGGGCGTGG + Exonic
1119652964 14:76396787-76396809 ACTCCCGGAGCCAGCGCTGGCGG + Intronic
1122183546 14:99972122-99972144 GCCCGCGGTGCCCCCGAGGGCGG + Intronic
1122975024 14:105167545-105167567 GGCCCCGGGGCCACCGGGAGCGG - Intronic
1123201169 14:106666004-106666026 GCGCGCGGGGCCACCGGGGGCGG - Intergenic
1124251347 15:28107875-28107897 GCCCCTGGGGACAACGCGGGGGG + Intergenic
1124545844 15:30626120-30626142 ACACCCGGAGCCACCACGGGGGG - Intronic
1124779362 15:32615507-32615529 ACACCCAGAGCCACCACGGGGGG - Exonic
1127789914 15:62390555-62390577 GCGCCCGGAGCCAGCGGCGGCGG + Intronic
1128322061 15:66701282-66701304 GCCCCTGGAGCCGGCGCGGCGGG - Intergenic
1129116409 15:73367748-73367770 GCCCCAGCAGCCACCGCAGCCGG - Exonic
1129726207 15:77903073-77903095 GCTCCCGGAGCAAACACGGGTGG - Intergenic
1136242161 16:28951233-28951255 GCCCCCGGAGCCCCCGGGGCCGG + Exonic
1136778846 16:32885146-32885168 ACCCCCGGAGCCGCCGCGGAGGG - Intergenic
1136891772 16:33976372-33976394 ACCCCCGGAGCCGCCGCGGAGGG + Intergenic
1137454783 16:48609984-48610006 GCCCCCGGCGCCGCCGCGGGAGG - Exonic
1137655217 16:50153404-50153426 GCCCGCGGAGCCCCCGAGGGCGG + Intronic
1139570106 16:67806462-67806484 GCCCCCAGCGCCCCCGCCGGAGG + Exonic
1139571663 16:67816708-67816730 GGCCCCGGAGGGACGGCGGGAGG - Intronic
1142044292 16:87915079-87915101 GCCCCAGGAGCCACCGAATGAGG + Intronic
1142259478 16:89036138-89036160 GACCTCGGAGCCACAGAGGGAGG - Intergenic
1142304488 16:89277931-89277953 GCCCACAGAGCCAACGCGTGTGG + Intronic
1203081260 16_KI270728v1_random:1147235-1147257 ATCCCCGGAGCCGCCGCGGAGGG - Intergenic
1142599654 17:1047402-1047424 GCCCTCAGAGCCACCGTGGATGG - Intronic
1142614141 17:1125225-1125247 GCGCCCGCAGCCAGGGCGGGGGG - Exonic
1142631712 17:1229845-1229867 GGCCGCGGAGCCGCCGGGGGAGG + Intergenic
1143554484 17:7651846-7651868 CCCCGCGGAGCCCCCTCGGGCGG + Intronic
1144465383 17:15492987-15493009 GCTGCCAGGGCCACCGCGGGGGG + Intronic
1144519513 17:15944786-15944808 GTCCCAGGAGCCGCCGCGAGAGG - Intergenic
1144816633 17:18039684-18039706 TCCCCCGGAGCCAGGGCTGGGGG - Exonic
1144835990 17:18157043-18157065 GCCCCTAGAGCCACCTCGAGTGG + Exonic
1144960022 17:19039650-19039672 ACCCCAGGAGCCCCCGGGGGAGG - Intronic
1144975138 17:19134874-19134896 ACCCCAGGAGCCCCCGGGGGAGG + Intronic
1148542732 17:48493101-48493123 GCCGCCGGGACCACCTCGGGAGG - Intergenic
1148549727 17:48543375-48543397 GCCCCCGGCACCACCTCCGGCGG + Exonic
1148648162 17:49230891-49230913 GCTCCCGGAGCCTCCGGGGCAGG - Intergenic
1150143503 17:62749827-62749849 GCCCCCGGTGCCACCGCTCAGGG + Intronic
1150823829 17:68457478-68457500 GCCCGTGGAGCCGGCGCGGGCGG - Intronic
1150840381 17:68601013-68601035 GCGCCGGCTGCCACCGCGGGCGG + Exonic
1151624421 17:75267718-75267740 GCCCCGGCAGCCACCCTGGGAGG - Intronic
1151674118 17:75589182-75589204 GCCGCCGCAGCCAGCGCAGGAGG - Intergenic
1152321376 17:79610329-79610351 GCAGCCGGAGCCCGCGCGGGTGG - Intergenic
1152406608 17:80101582-80101604 GACCCCGGAGTCTCCGCGGGCGG + Intergenic
1152608275 17:81303692-81303714 GGTCCCGGAGCCACCTGGGGAGG - Intergenic
1152628715 17:81400026-81400048 GCCCAGGCAGCCACCGCGGCCGG - Intronic
1152748331 17:82051402-82051424 GCCCCCGGAGGCTCCGCGCGGGG - Intronic
1152798788 17:82321670-82321692 GCCCCCGGGGCTGCCGCGGAAGG + Exonic
1153675462 18:7452625-7452647 GCCCACTGAGCCAACGCGGATGG - Intergenic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1160452500 18:78974710-78974732 GTCTCCGGACCCACCCCGGGAGG - Intergenic
1160710840 19:550289-550311 GCCCCAGGAGCCACGCGGGGAGG - Intergenic
1160910007 19:1469941-1469963 CCCCCCGGGGCCCCCGCCGGCGG + Exonic
1160941382 19:1621885-1621907 GCCCCCGGAGCCACGTACGGCGG - Exonic
1160991793 19:1863208-1863230 GGACCCGGAGCCGCCCCGGGGGG - Exonic
1161853945 19:6753208-6753230 GCCCCCAGAGCCACCTCCGCGGG - Intronic
1162128243 19:8510877-8510899 GCCCCCGCGGCCCCCGCGGCCGG - Exonic
1162140228 19:8580860-8580882 GCACCCGGAGCCACAGCTGGCGG - Exonic
1162445074 19:10718034-10718056 GCCCCCGGGGCCGGGGCGGGAGG + Intergenic
1162744266 19:12790105-12790127 TCCCCTGCAGGCACCGCGGGCGG + Intronic
1163666556 19:18606468-18606490 GCCCCGGGGGCAGCCGCGGGGGG - Intronic
1165161773 19:33820654-33820676 GCCCGCGGAGCCCCCATGGGTGG + Intergenic
1165382379 19:35490363-35490385 GCCCAGGGAGCCACCCTGGGTGG - Exonic
1166360417 19:42250810-42250832 GCCCCGGGACCCACCGCCGACGG - Intronic
1166718302 19:44983205-44983227 GCCCCCAGAGCCCCCGCTGTTGG + Intronic
1166840117 19:45692224-45692246 GCCCCCGAAGTCACGGCCGGCGG - Exonic
1167375377 19:49108199-49108221 GCCACCGGAGCGAGCGCGAGCGG + Exonic
1167613316 19:50517658-50517680 GCCCCCGCAGCCCCCGCCGCTGG + Exonic
1167641869 19:50686837-50686859 GCCCAGGGAGCCCCCGGGGGCGG + Intronic
1168689717 19:58369132-58369154 GCCCCGGGAGCCCCCGCCTGGGG + Exonic
927472113 2:23384918-23384940 GAGCCGGGGGCCACCGCGGGGGG + Intergenic
927964001 2:27258046-27258068 GCCCCCAGAGTCTCTGCGGGTGG + Exonic
927989919 2:27440844-27440866 GCCCCAGCAGCCACAGCAGGAGG + Exonic
930730417 2:54723614-54723636 GCCCCCGGAGCCCCGGCTGGAGG + Intronic
936985726 2:118310185-118310207 GCCATCGGCGCCATCGCGGGCGG - Intergenic
938073294 2:128319242-128319264 GTCCCCGCAGCCCGCGCGGGAGG + Intergenic
938187602 2:129245831-129245853 GCACCCTGAGCCACTGCTGGGGG - Intergenic
938368823 2:130756221-130756243 GCCCCTGGAGCCGCGGTGGGTGG + Intronic
941905575 2:170714674-170714696 GCCCTCGGCCCCACCGCGGCGGG + Intergenic
943767572 2:191678732-191678754 GCCCCGGGAGGCACAGCGGGCGG - Intronic
945080934 2:206085683-206085705 GCCTCCGGGGCGCCCGCGGGCGG - Intronic
948888827 2:240897099-240897121 GCCCCTGTAGCCACCGCACGTGG + Intergenic
1172133681 20:32673226-32673248 GCCCCTGGAGCCACAGAGGCAGG + Intergenic
1179550506 21:42140734-42140756 GACCCCTGAGCCTCCCCGGGAGG + Intronic
1180799756 22:18626256-18626278 GCCCCTGCAGCCAGGGCGGGTGG + Intergenic
1180831902 22:18910869-18910891 GCCCCCGGCCCCACGGCAGGCGG + Exonic
1181221959 22:21369010-21369032 GCCCCTGCAGCCAGGGCGGGTGG - Intergenic
1181637348 22:24180649-24180671 GCCCCTGCAGCCAGGGCGGGTGG - Intergenic
1185047516 22:48536431-48536453 GCACCGGGAGCCGGCGCGGGTGG + Intronic
1203281980 22_KI270734v1_random:136140-136162 GCCCCCGGCCCCACGGCAGGCGG + Intergenic
951558896 3:23946170-23946192 GCCCGCTGAGCCCCCGCGGCGGG + Intronic
953899910 3:46834069-46834091 GCCCCGGGAGCCGCCGCCAGAGG + Exonic
955508454 3:59655386-59655408 GCCCCCTGACCTACCGTGGGGGG - Intergenic
956468639 3:69542624-69542646 GCCCCCGGAGAGGCGGCGGGCGG - Intergenic
959085774 3:101849544-101849566 GCTCCCTGAGCCAGCCCGGGAGG + Exonic
961649152 3:128408815-128408837 GCCCCAGGAGCCACCTAGTGGGG - Intergenic
961651917 3:128421058-128421080 GCCCCAGGAGCCAGCGTGGCAGG + Intergenic
968548434 4:1210353-1210375 GCCCCCTGGGCCACTGAGGGAGG - Intergenic
968942077 4:3644116-3644138 GCCCCTGGGGGCTCCGCGGGAGG - Intergenic
969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG + Intronic
969379217 4:6783087-6783109 GGCCCCGGAGCCCCCGGCGGCGG - Intronic
978072536 4:104491320-104491342 GCCGCCGCCGCCACCGCCGGCGG + Exonic
983538021 4:168878332-168878354 GCCCTCGCAGCCGCCGCCGGCGG + Intronic
987379907 5:17275544-17275566 GCCCCCGGCCCCGCTGCGGGCGG + Exonic
992487548 5:77210747-77210769 GTCCCCGGAGGCTCGGCGGGGGG + Intronic
995509389 5:112892970-112892992 GCCGCAGGAGCCACCGCAGCCGG + Exonic
998266796 5:140672960-140672982 GCCCACGGACCCAGCGCGCGGGG + Intronic
1001476261 5:172053109-172053131 GCCCTCGTAGCCACAGCGTGAGG - Intronic
1002445677 5:179288519-179288541 TCCCCCGGAGCCACCCTGGGTGG - Intronic
1002769973 6:282327-282349 GCCGCTGGAGCCACGGCAGGGGG - Intergenic
1002785798 6:398951-398973 GCTCCTGGAGGCACCGCAGGAGG + Intronic
1006801927 6:36765220-36765242 ACCCCCAGAGCCACTGCGGGGGG + Intronic
1008109587 6:47477988-47478010 TCCCCAGGAGCCACGGCGGCGGG - Exonic
1018902484 6:168058536-168058558 GCCCCCGGCTCCACCACAGGAGG - Intronic
1019331704 7:463606-463628 GGCCCCGGCCCCACTGCGGGCGG + Intergenic
1019649703 7:2150211-2150233 GCCCCCAGAGCAGCCTCGGGTGG + Intronic
1020100029 7:5389300-5389322 GAGCCCGGAGCCCCCGCGGTGGG + Exonic
1020323611 7:6957909-6957931 GCCCCCTTAGCCACTGTGGGGGG + Intergenic
1021510532 7:21428139-21428161 CTCCTCCGAGCCACCGCGGGCGG + Exonic
1022020904 7:26398627-26398649 GCCCCGGGAGCCGCGGCGGCCGG - Intergenic
1022698120 7:32729101-32729123 GCCCCCGGCGCCCCGGCGGAAGG - Intergenic
1022741811 7:33129300-33129322 GCCCCCGGAGCCCAGGCAGGAGG + Intronic
1026765266 7:73155757-73155779 GGCCCCGTCGCCACGGCGGGGGG + Intergenic
1026840583 7:73668230-73668252 CCCCGCGGAGCCACCCCCGGGGG + Intronic
1027041740 7:74965513-74965535 GGCCCCGTCGCCACGGCGGGGGG + Intronic
1027081902 7:75236856-75236878 GGCCCCGTCGCCACGGCGGGGGG - Intergenic
1028762495 7:94510449-94510471 GCCCCCGACCCCAGCGCGGGCGG - Intronic
1029390490 7:100271400-100271422 GCCCCCGTCGCCACGGCGTGGGG - Intronic
1033288553 7:140062489-140062511 GCGCCGGGAGCGACGGCGGGCGG - Intronic
1033361257 7:140640508-140640530 GCCCGCGGAGCCGCCGCCCGCGG - Exonic
1034440005 7:151081536-151081558 GCCCGCGGAGGCACTACGGGCGG + Exonic
1035218717 7:157391479-157391501 CCCCCAGCAGCCACCGCAGGAGG - Intronic
1035264383 7:157683054-157683076 GGCCCTGGAGCCACAACGGGAGG + Intronic
1038041422 8:23727064-23727086 GCCGCCGGCGCCAGGGCGGGTGG + Intergenic
1038828588 8:31033270-31033292 GCCCCCGCAGCGGCCGCAGGAGG - Exonic
1040065324 8:43140368-43140390 GCCGCCTGAGTCACCGCGGGAGG - Intergenic
1040329500 8:46378687-46378709 GCCCCCGGGGCCATCCCGGGCGG + Intergenic
1040330954 8:46385538-46385560 GCCCCCAGGGCTACCCCGGGCGG + Intergenic
1044523864 8:93229901-93229923 GCGGCCGGAGCCACCGAGTGAGG + Intergenic
1049306962 8:141909107-141909129 CTCAGCGGAGCCACCGCGGGAGG - Intergenic
1049571130 8:143370786-143370808 GCCCCTGCAGCCCCTGCGGGAGG - Intronic
1053281197 9:36820699-36820721 GCCCAGGAAGCCACCGTGGGAGG + Intergenic
1056992347 9:91423726-91423748 GCCTCCGGGGCCGCGGCGGGAGG + Exonic
1059769925 9:117415125-117415147 GCCCCGGGAGGCGGCGCGGGGGG - Intergenic
1060192006 9:121599435-121599457 GGCCCGGGACCCAGCGCGGGCGG - Intronic
1060224068 9:121780788-121780810 GCCCACTGAGCTTCCGCGGGTGG + Intronic
1061208505 9:129177607-129177629 GCGGCCGGAGCGCCCGCGGGCGG - Exonic
1062241991 9:135545841-135545863 GCACCCCGAGCCACAGAGGGAGG - Intergenic
1062277234 9:135736748-135736770 GCCCACGGAGCCCCCGCCGCGGG - Intronic
1062461937 9:136665888-136665910 ACCCGCGGAGCCCCCGGGGGCGG + Intronic
1062598788 9:137310978-137311000 GCCCCTGGAGCCTCCGGGTGTGG + Intronic
1062614977 9:137392271-137392293 GCCTCCTGACCCAGCGCGGGAGG + Intronic
1062626036 9:137441829-137441851 GCCCCGGGACCCACGGCGAGCGG - Intergenic
1203794010 EBV:166599-166621 CCCCCTGGAGCCAGCGCTGGGGG - Intergenic
1190222570 X:48521864-48521886 GAGCCCGGAGCCAGCGTGGGAGG + Exonic
1194399985 X:93430978-93431000 GCCCTCTTAGCCACTGCGGGGGG - Intergenic
1194977596 X:100409724-100409746 GCCGCCGCCGCCGCCGCGGGAGG + Exonic
1197730643 X:129806390-129806412 GCCCCCAGAGCCACCACAGGAGG - Exonic
1198215525 X:134550906-134550928 GCCCCCGGGGCCAACGCGCTCGG - Intergenic
1199772467 X:150983660-150983682 GCCCCTGGGGCCGCCACGGGCGG - Intronic
1200100952 X:153688894-153688916 ACCCCCGGAGCCGCCGCGGAGGG + Intronic