ID: 901443517

View in Genome Browser
Species Human (GRCh38)
Location 1:9293254-9293276
Sequence AGGCGCCCCCGGAGCCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443517_901443525 2 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443525 1:9293279-9293301 CTCGCCGCGGCTCCTGGGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 142
901443517_901443527 4 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443527 1:9293281-9293303 CGCCGCGGCTCCTGGGAGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 179
901443517_901443529 10 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443517_901443522 -3 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443517_901443526 3 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443517_901443520 -4 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443520 1:9293273-9293295 GCCTCCCTCGCCGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443517 Original CRISPR AGGCGCCCCCGGAGCCACCG CGG (reversed) Intronic