ID: 901443518

View in Genome Browser
Species Human (GRCh38)
Location 1:9293265-9293287
Sequence CGCGGCGAGGGAGGCGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443518_901443536 26 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443536 1:9293314-9293336 CCCCGCGCTGCCGCCGCTGCAGG 0: 2
1: 6
2: 10
3: 67
4: 409
901443518_901443525 -9 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443525 1:9293279-9293301 CTCGCCGCGGCTCCTGGGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 142
901443518_901443527 -7 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443527 1:9293281-9293303 CGCCGCGGCTCCTGGGAGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 179
901443518_901443538 27 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443538 1:9293315-9293337 CCCGCGCTGCCGCCGCTGCAGGG 0: 1
1: 1
2: 0
3: 24
4: 225
901443518_901443526 -8 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443518_901443529 -1 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443518 Original CRISPR CGCGGCGAGGGAGGCGCCCC CGG (reversed) Intronic