ID: 901443519

View in Genome Browser
Species Human (GRCh38)
Location 1:9293266-9293288
Sequence CGGGGGCGCCTCCCTCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443515_901443519 -7 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
901443516_901443519 -10 Left 901443516 1:9293253-9293275 CCCGCGGTGGCTCCGGGGGCGCC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
901443513_901443519 -6 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147
901443511_901443519 -5 Left 901443511 1:9293248-9293270 CCCCTCCCGCGGTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 11
4: 154
Right 901443519 1:9293266-9293288 CGGGGGCGCCTCCCTCGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443519 Original CRISPR CGGGGGCGCCTCCCTCGCCG CGG Intronic