ID: 901443522

View in Genome Browser
Species Human (GRCh38)
Location 1:9293274-9293296
Sequence CCTCCCTCGCCGCGGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443516_901443522 -2 Left 901443516 1:9293253-9293275 CCCGCGGTGGCTCCGGGGGCGCC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443515_901443522 1 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443511_901443522 3 Left 901443511 1:9293248-9293270 CCCCTCCCGCGGTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 11
4: 154
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443517_901443522 -3 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234
901443513_901443522 2 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443522 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443522 Original CRISPR CCTCCCTCGCCGCGGCTCCT GGG Intronic