ID: 901443526

View in Genome Browser
Species Human (GRCh38)
Location 1:9293280-9293302
Sequence TCGCCGCGGCTCCTGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443513_901443526 8 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443518_901443526 -8 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443516_901443526 4 Left 901443516 1:9293253-9293275 CCCGCGGTGGCTCCGGGGGCGCC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443517_901443526 3 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443515_901443526 7 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
901443511_901443526 9 Left 901443511 1:9293248-9293270 CCCCTCCCGCGGTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 11
4: 154
Right 901443526 1:9293280-9293302 TCGCCGCGGCTCCTGGGAGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443526 Original CRISPR TCGCCGCGGCTCCTGGGAGA GGG Intronic