ID: 901443529

View in Genome Browser
Species Human (GRCh38)
Location 1:9293287-9293309
Sequence GGCTCCTGGGAGAGGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 0, 2: 6, 3: 92, 4: 662}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443518_901443529 -1 Left 901443518 1:9293265-9293287 CCGGGGGCGCCTCCCTCGCCGCG 0: 1
1: 0
2: 4
3: 17
4: 267
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443515_901443529 14 Left 901443515 1:9293250-9293272 CCTCCCGCGGTGGCTCCGGGGGC 0: 1
1: 0
2: 1
3: 23
4: 191
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443517_901443529 10 Left 901443517 1:9293254-9293276 CCGCGGTGGCTCCGGGGGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443513_901443529 15 Left 901443513 1:9293249-9293271 CCCTCCCGCGGTGGCTCCGGGGG 0: 1
1: 0
2: 3
3: 16
4: 124
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443521_901443529 -10 Left 901443521 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 3
3: 39
4: 333
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443516_901443529 11 Left 901443516 1:9293253-9293275 CCCGCGGTGGCTCCGGGGGCGCC 0: 1
1: 0
2: 1
3: 16
4: 234
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662
901443511_901443529 16 Left 901443511 1:9293248-9293270 CCCCTCCCGCGGTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 11
4: 154
Right 901443529 1:9293287-9293309 GGCTCCTGGGAGAGGGGCCCAGG 0: 1
1: 0
2: 6
3: 92
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443529 Original CRISPR GGCTCCTGGGAGAGGGGCCC AGG Intronic