ID: 901443540

View in Genome Browser
Species Human (GRCh38)
Location 1:9293319-9293341
Sequence CGCTGCCGCCGCTGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 362}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901443532_901443540 -9 Left 901443532 1:9293305-9293327 CCAGGCCCGCCCCGCGCTGCCGC 0: 1
1: 2
2: 14
3: 135
4: 1149
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362
901443531_901443540 -8 Left 901443531 1:9293304-9293326 CCCAGGCCCGCCCCGCGCTGCCG 0: 1
1: 0
2: 5
3: 40
4: 450
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362
901443521_901443540 22 Left 901443521 1:9293274-9293296 CCTCCCTCGCCGCGGCTCCTGGG 0: 1
1: 0
2: 3
3: 39
4: 333
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362
901443524_901443540 18 Left 901443524 1:9293278-9293300 CCTCGCCGCGGCTCCTGGGAGAG 0: 1
1: 0
2: 1
3: 23
4: 167
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362
901443530_901443540 5 Left 901443530 1:9293291-9293313 CCTGGGAGAGGGGCCCAGGCCCG 0: 1
1: 0
2: 3
3: 41
4: 548
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362
901443523_901443540 19 Left 901443523 1:9293277-9293299 CCCTCGCCGCGGCTCCTGGGAGA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362
901443528_901443540 13 Left 901443528 1:9293283-9293305 CCGCGGCTCCTGGGAGAGGGGCC 0: 1
1: 0
2: 3
3: 37
4: 331
Right 901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG 0: 1
1: 0
2: 4
3: 45
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901443540 Original CRISPR CGCTGCCGCCGCTGCAGGGC AGG Intronic