ID: 901444625

View in Genome Browser
Species Human (GRCh38)
Location 1:9300522-9300544
Sequence AGTTATTTGTGGATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 4, 2: 11, 3: 57, 4: 510}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901444625_901444628 4 Left 901444625 1:9300522-9300544 CCTGCCATCATCCACAAATAACT 0: 1
1: 4
2: 11
3: 57
4: 510
Right 901444628 1:9300549-9300571 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
901444625_901444630 15 Left 901444625 1:9300522-9300544 CCTGCCATCATCCACAAATAACT 0: 1
1: 4
2: 11
3: 57
4: 510
Right 901444630 1:9300560-9300582 GACAGCTCTTGGCCTAATACTGG 0: 1
1: 17
2: 196
3: 211
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901444625 Original CRISPR AGTTATTTGTGGATGATGGC AGG (reversed) Intronic
901032014 1:6312614-6312636 AATTAGTTGGGTATGATGGCGGG - Intronic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
901939002 1:12647802-12647824 AGTTATCTGGGCATGGTGGCAGG - Intronic
903008838 1:20316312-20316334 CGTTATTTGTGGATGCAGGGAGG + Intronic
903622433 1:24707703-24707725 ACTGATTTGTGGATGGTGGATGG - Intergenic
903772076 1:25770318-25770340 ACTTATTTCTGGATCAGGGCTGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904937457 1:34141703-34141725 ACTTATTTCTGAATGATGCCAGG + Intronic
905322097 1:37125120-37125142 AGTTCTGTGTGACTGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910141286 1:84029987-84030009 AGTTATTTGTGAAGGATGGCAGG - Intergenic
910223661 1:84915244-84915266 AGTTAGCTGGGCATGATGGCGGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG + Intergenic
910590428 1:88924107-88924129 AGTGATTTGTGGTTAAAGGCTGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911974258 1:104471704-104471726 AGTTATATCTGGAGGATGTCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
915056684 1:153139292-153139314 AGGTATTTGTGGGGGATGGGGGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG + Intergenic
916621826 1:166506148-166506170 AGTTAGCTGGGCATGATGGCGGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917276495 1:173337194-173337216 AGTTATCTGTGGAGTATTGCAGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919404988 1:197167975-197167997 AGTTATCTGTGAATAATGACAGG - Intronic
920167024 1:204043334-204043356 AATTAGCTGGGGATGATGGCGGG - Intergenic
921789593 1:219274532-219274554 AGTTAGTTGGGCATGGTGGCAGG - Intergenic
922683081 1:227617095-227617117 AGTGTTCTATGGATGATGGCAGG - Intronic
923722448 1:236478733-236478755 AGTTATCTGGGCGTGATGGCGGG - Intronic
923750534 1:236742354-236742376 AGTAATTAGTTGTTGATGGCTGG + Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924552267 1:245089757-245089779 AGTGATTTTTGGAAGATGGGTGG + Intronic
924745569 1:246830650-246830672 AATTATGTGTGTGTGATGGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065167203 10:22992040-22992062 AGTTGTTTTTTGCTGATGGCAGG + Intronic
1065470312 10:26073274-26073296 AATTATTTTTGGATGAGGCCGGG + Intronic
1066555627 10:36609577-36609599 AATTATCTGTGCACGATGGCAGG + Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068184074 10:53563225-53563247 TGTTTTACGTGGATGATGGCAGG - Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070052295 10:72900917-72900939 AATTATGTGGGTATGATGGCAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071846456 10:89526041-89526063 AGTGATTTGTGCATGATGCAGGG + Intronic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071947089 10:90657733-90657755 AGTTATCTATGGATAAAGGCAGG + Intergenic
1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG + Intergenic
1072122263 10:92414931-92414953 AATTATTTGGGTATGGTGGCAGG - Intergenic
1073189757 10:101642981-101643003 TATTATTTGGGGAGGATGGCAGG - Intronic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073855057 10:107664047-107664069 CATTTTATGTGGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074319766 10:112391228-112391250 AGTTAGTTGCGCATGGTGGCAGG + Intronic
1076367691 10:129932820-129932842 GGTTGTTTGAGGATGACGGCTGG - Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077381072 11:2237901-2237923 GGTTATCTGTGGATGGTGGCAGG - Intergenic
1077396475 11:2325982-2326004 GGTTATCTGTGGATGATGACAGG - Intergenic
1077401198 11:2358466-2358488 GGTTATCTGTGAATGATGACAGG - Intergenic
1078212679 11:9283443-9283465 AGTTTTTTTTGGAAGATGGCTGG + Exonic
1078457562 11:11487003-11487025 ACTTATTGGAGGATGATGGGTGG - Intronic
1079047911 11:17124809-17124831 ATTTATTTGTTGATGATACCAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081149461 11:39609026-39609048 AAATATTTGTGGATACTGGCTGG + Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081640731 11:44751776-44751798 AATTATTTGGACATGATGGCAGG + Intronic
1082656665 11:55866127-55866149 AATTATCTGTGCATGATGGTGGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085618164 11:78017591-78017613 AATTAGTTGGGCATGATGGCAGG - Intronic
1086006285 11:82041849-82041871 AATTAGTTGTGTCTGATGGCCGG + Intergenic
1087021607 11:93608755-93608777 AGTTATTTGTTGGTAATGGCAGG + Intergenic
1088156830 11:106815882-106815904 AGCTTTTTGTGGCTGCTGGCAGG - Intronic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091113693 11:132994494-132994516 AGTTATTTGTGCCTGGTCGCTGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092588693 12:9928316-9928338 AATTAGCTGTGCATGATGGCAGG + Intronic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094597541 12:31878821-31878843 AGTTCATAATGGATGATGGCTGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096169286 12:49454009-49454031 AGTTAGTTGGGCATGGTGGCGGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097313942 12:58152163-58152185 TGTTATCTATGGATGATGGTAGG + Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100231944 12:92617827-92617849 AGTTAGCTGTGGATGGTGGTGGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101591126 12:106126447-106126469 TGTAACTTGGGGATGATGGCAGG - Intronic
1102171687 12:110847236-110847258 ATTTATTTATGCATGATTGCGGG - Intronic
1102279713 12:111609300-111609322 AATTAGTTGGGCATGATGGCGGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103765620 12:123277458-123277480 AATTATCTGTGCATGGTGGCGGG - Intergenic
1104230093 12:126876362-126876384 ACTTAGTTGGGCATGATGGCGGG + Intergenic
1105467754 13:20662037-20662059 TGTTGTTGGTGGATGATGTCGGG + Intronic
1105990610 13:25616478-25616500 AATTATCTGTGCATGGTGGCGGG - Intronic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1106503490 13:30351493-30351515 AATTATCTGTGTATGGTGGCAGG + Intergenic
1106725367 13:32478984-32479006 AATTAGTTGGGAATGATGGCGGG + Intronic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108923277 13:55703225-55703247 TTTTATTTGTGGAATATGGCTGG + Intergenic
1109325407 13:60861352-60861374 AGATATTTGGGGATGAAGGATGG - Intergenic
1110330140 13:74262294-74262316 AATATTTTGTGAATGATGGCTGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112934107 13:104777857-104777879 AGTTAGCTGTGCATGGTGGCAGG - Intergenic
1113191115 13:107747314-107747336 AGTTAGTTGTACAAGATGGCAGG - Intronic
1113516914 13:110910454-110910476 AGTTGTTTGTGGAGGATAGTAGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115209938 14:30957007-30957029 AATTAGTTGTGCATGATGGCAGG + Intronic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116228248 14:42181310-42181332 GGATATTGGTGGTTGATGGCTGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116960547 14:50963879-50963901 AATTAGTTGGGCATGATGGCGGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117454809 14:55886388-55886410 AGTGAGTAGTGGAAGATGGCTGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117709530 14:58510939-58510961 AGTTATTTTGGGGTGATGGTAGG + Intronic
1118385505 14:65252570-65252592 AGTTATTTGTGAATGATGGCAGG + Intergenic
1118501832 14:66369364-66369386 AGTTATCTGTGGATGATTGCAGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120866567 14:89300329-89300351 AATTATCTGGGCATGATGGCGGG - Intronic
1122737502 14:103851476-103851498 AGTTATCTGAGCATGATGGTGGG + Intergenic
1123202345 14:106678658-106678680 ACTTATTTGTTGATGAAGGTTGG - Intergenic
1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG + Intergenic
1124547618 15:30646233-30646255 TGCTATTTGTGCATGGTGGCTGG + Exonic
1125702421 15:41698916-41698938 AGTCATTTGTGGTTGATGCCTGG - Exonic
1125922660 15:43534800-43534822 AGTTCTCTGTGGAGGTTGGCAGG - Exonic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129017033 15:72477584-72477606 TGTTATTTGTGGATATTTGCAGG + Intronic
1129490854 15:75924212-75924234 AGTGATTTGAGGAGGAGGGCCGG + Intronic
1129921675 15:79324488-79324510 ATTTATTTATGGATGATGATGGG + Intronic
1130096793 15:80862100-80862122 AGCCTTTTGTGGATGATGCCTGG + Intronic
1130852112 15:87804934-87804956 AGTTGTGTTTGGATGATGGCTGG + Intergenic
1130877734 15:88028908-88028930 AGTTGTTCATGGATGAGGGCTGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132490995 16:230897-230919 AGTTAGTCGGGAATGATGGCGGG - Intergenic
1133799724 16:9075224-9075246 AATTATTTGTTGTTGAGGGCTGG - Intergenic
1134684178 16:16147162-16147184 AAGTATCTGTGGATGATGGATGG + Intergenic
1135061641 16:19276033-19276055 AGTTATCTGCGGATGATGCACGG + Intergenic
1135625999 16:23995469-23995491 AGCTATCTGTGGATTATGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138050134 16:53767827-53767849 AGTTATTTTTAGATGATTTCTGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142128687 16:88422498-88422520 AGTGATGGGTGGATGATGGGTGG + Intergenic
1143145272 17:4771405-4771427 AGTTATCTGTGCATGGTGGCGGG - Intergenic
1143160882 17:4870054-4870076 AGTTAGCTGGGCATGATGGCGGG - Intronic
1143777798 17:9210755-9210777 AATTAGCTGTGCATGATGGCAGG + Intronic
1144055203 17:11534499-11534521 ACTAATTTCTTGATGATGGCAGG - Intronic
1145016334 17:19400741-19400763 AGTTATTTGGGCTTGGTGGCAGG + Intergenic
1146074306 17:29713833-29713855 GGTTATTTTTGGATGGTGACTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147285119 17:39396445-39396467 AATTAGTTGTGCATGGTGGCGGG + Intronic
1148501264 17:48093115-48093137 AATTAGTTGGGCATGATGGCAGG + Intronic
1149335965 17:55636295-55636317 AGTTATTTAAGGGTGATGACAGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151039552 17:70842903-70842925 AATTAGTTGGGGATGGTGGCAGG - Intergenic
1152653021 17:81504915-81504937 GGTTATTTGTGGAAGAAGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153184388 18:2470716-2470738 AATTATTTGTGGAGGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153840904 18:9006952-9006974 AGTTCTTTGTAGATTCTGGCTGG - Intergenic
1154394163 18:13971465-13971487 AGTGATTTATGTATGAGGGCAGG - Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1154510085 18:15089856-15089878 ATTTCTATATGGATGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156181894 18:34614510-34614532 GGATATTTGTGGTTCATGGCAGG + Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1158595350 18:58811023-58811045 AATTAGTTGGGCATGATGGCAGG - Intergenic
1159277137 18:66235494-66235516 AGTTATCTGTGAATGCTGGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161928811 19:7321934-7321956 AGTTATCTGGGCATGGTGGCGGG + Intergenic
1161928845 19:7322268-7322290 AGTTATCTGGGCATGGTGGCGGG - Intergenic
1162106363 19:8372203-8372225 AATTATCTGTGCATGGTGGCGGG - Intronic
1163371224 19:16902366-16902388 AGTTAGTTGGGCATGATGGCGGG + Intronic
1163418054 19:17198584-17198606 AATTAGTTGGGCATGATGGCAGG + Intronic
1163598712 19:18235140-18235162 AGTTGTTGGTGGATGCTAGCAGG - Intronic
1163609854 19:18295188-18295210 ACTGATTGGTGGATGATGGATGG - Intergenic
1164030085 19:21396064-21396086 AATTATCTGGGTATGATGGCAGG - Intergenic
1164101588 19:22059294-22059316 AGTTGATGGTGGATGATGGGAGG - Intronic
1164500118 19:28812224-28812246 AGTTAGTTGGGCGTGATGGCGGG - Intergenic
1167395433 19:49225356-49225378 AGTTATCTGGGCATGGTGGCAGG - Intergenic
1168127643 19:54294908-54294930 AGATATTTTTGGATGGGGGCCGG - Intergenic
1168496000 19:56851988-56852010 AGTCTTATGTGGATGGTGGCAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1168651798 19:58096779-58096801 AGTGATCTGTGGATGAAGCCAGG - Intronic
925359684 2:3268626-3268648 AGGTCTTTGTGGATGAGGTCAGG - Intronic
925364255 2:3300700-3300722 ACTTATTTCTGGATGATGCTGGG + Intronic
925413546 2:3654120-3654142 AGTTATTGCTGGCTGTTGGCAGG + Intergenic
926035984 2:9636167-9636189 AGTTATTTGAGGTTGGTGGGTGG + Intergenic
926161467 2:10492994-10493016 AATTATCTGGGCATGATGGCAGG + Intergenic
926574971 2:14570155-14570177 ATTTATTTGTGGCTATTGGCTGG - Intergenic
928425334 2:31173022-31173044 AGATATTTTTGGGTGATGGGAGG - Intergenic
930640270 2:53847381-53847403 AGTTACTTGGGCATGGTGGCAGG - Intergenic
932524181 2:72445593-72445615 AGTCATATGTGGATAGTGGCAGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936381666 2:111992048-111992070 ATTTCTTTATGGATGAGGGCAGG - Intronic
936404431 2:112189432-112189454 GGTCTTTTGTGGATAATGGCTGG + Intergenic
936646294 2:114376411-114376433 AATTATCTGTGGATAATGGCAGG + Intergenic
936818306 2:116487282-116487304 ATTTATTTATGGATAATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938505310 2:131874310-131874332 ATTTCTATATGGATGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939161799 2:138599119-138599141 AGTTATTTGTGGAGATTTGCGGG + Intergenic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939868714 2:147504102-147504124 AGTTATTTGTGCATGAAGCTTGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943263575 2:185697222-185697244 AGATATCTGTGGATAATGGCAGG - Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944226126 2:197350259-197350281 AGTTATCTGGGCATGGTGGCGGG + Intergenic
944695248 2:202194915-202194937 AATTATCTGTGCATGGTGGCGGG - Intronic
944813172 2:203348090-203348112 AGTTAGCTGGGCATGATGGCGGG + Intronic
945127885 2:206533348-206533370 AATTATTTGGGCATGGTGGCAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947021711 2:225684697-225684719 AATTATCTGGGCATGATGGCAGG - Intergenic
947151266 2:227118450-227118472 AGGACTTTGTGGATGATGGAAGG - Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947785983 2:232820608-232820630 AATTATTGCTGGGTGATGGCCGG - Intronic
1170996605 20:21366399-21366421 AGTTATCTGGGCATGGTGGCAGG + Intronic
1171041017 20:21763599-21763621 AGTCATGTGAGGATGATGGTGGG + Intergenic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1171753037 20:29073876-29073898 AATTAGTTGTGCATGGTGGCGGG - Intergenic
1172248793 20:33464444-33464466 AGTTATCTGGGCATGGTGGCAGG + Intergenic
1172561668 20:35894245-35894267 TGTTATTTCTGGAACATGGCTGG - Intronic
1173528455 20:43750424-43750446 ATATATTTATGGATGATGGATGG - Intergenic
1174125054 20:48298205-48298227 GGTTCTTTGTGGCTGTTGGCTGG + Intergenic
1174287069 20:49481350-49481372 AGTTGGTTGTGGATGCTTGCGGG - Intronic
1174456770 20:50654313-50654335 AATTAGTTGGGCATGATGGCAGG - Intronic
1175069298 20:56318437-56318459 AATTATTCGGGCATGATGGCAGG + Intergenic
1176705070 21:10110462-10110484 AATTATCTGGGCATGATGGCAGG - Intergenic
1176787787 21:13279568-13279590 ATTTCTATATGGATGATGGCAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177986926 21:27987766-27987788 AATTCTATATGGATGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179257279 21:39727689-39727711 AGTCATTTGGAGATGGTGGCTGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180023431 21:45143857-45143879 TGTTATTCTAGGATGATGGCTGG - Intronic
1180164535 21:46017138-46017160 TGTTACTTCTGGATGGTGGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180752130 22:18131689-18131711 ATTTATGTGTGTATGAGGGCAGG - Exonic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG + Intergenic
1182135100 22:27894125-27894147 TGTTATTTGTGGAAAATGGTTGG - Intronic
1182339563 22:29608518-29608540 ATTTAGTTGGGCATGATGGCGGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949620926 3:5810768-5810790 AGTGATTAGTGAATAATGGCAGG - Intergenic
949731823 3:7122782-7122804 AGTTATTTGTGTCTGATGGGAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952365676 3:32672810-32672832 AATTATTTGGGCATGGTGGCAGG + Intergenic
952879123 3:37972194-37972216 AATTATTTGTTGATGATGATAGG + Intronic
953642196 3:44719120-44719142 AATTAGTTGGGCATGATGGCAGG - Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956138032 3:66118067-66118089 ACTTATTTGTGGATGACTCCTGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960380992 3:116961461-116961483 AGTTATTTCTGCATGTTGGTTGG + Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960510685 3:118545381-118545403 ATCTATATGTAGATGATGGCAGG - Intergenic
961481155 3:127181787-127181809 AATTAGCTGGGGATGATGGCAGG + Intergenic
962267392 3:133953673-133953695 AGATCTTTGTGGACTATGGCAGG - Exonic
962558685 3:136582859-136582881 AGTTATTTGTGGAGATTTGCTGG - Intronic
962733217 3:138301765-138301787 ATTTCTTTGTGGATGGTGGGTGG - Intronic
962894195 3:139699188-139699210 AGTTATATGGGGATGAGGGAAGG - Intergenic
963418684 3:145031155-145031177 AGTTAATTGGAGATGCTGGCAGG + Intergenic
964199125 3:154098282-154098304 AGTTGTTTGTGGTTAATGCCTGG + Intergenic
964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG + Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966274277 3:178145957-178145979 AGATATTAGTGGAGGAGGGCTGG + Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
966754725 3:183358140-183358162 AATTATCTGGGCATGATGGCGGG + Intronic
966946844 3:184782872-184782894 AGTTAGCTGTGCATGGTGGCAGG + Intergenic
967426496 3:189333236-189333258 AATTAGCTGTGCATGATGGCGGG + Intergenic
967487332 3:190048346-190048368 AGTTATCTGGGCATGGTGGCAGG + Intronic
967972140 3:195006752-195006774 AATGATTTGTGGCTGATGGTTGG - Intergenic
968309326 3:197670035-197670057 AGCTAGTTGGGCATGATGGCGGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970702929 4:18764208-18764230 AATTATCTGTGCATGGTGGCAGG + Intergenic
971334295 4:25708385-25708407 AGTTAGCTGGGCATGATGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972157264 4:36179974-36179996 AGATATTTGTGCTTGATGGCTGG + Intronic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
972957492 4:44410669-44410691 TGTCTTATGTGGATGATGGCAGG + Intronic
973024171 4:45246272-45246294 AGTTATTTGAAGATGATTACTGG - Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976606238 4:86985727-86985749 AGTTACTTTTGGAAAATGGCAGG + Intronic
976911695 4:90314993-90315015 AATTATCTGTGCATGGTGGCAGG - Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979019684 4:115480744-115480766 AATTATTTGGGCATGGTGGCAGG + Intergenic
979050916 4:115931395-115931417 ATTTATATTTGGATGATGACTGG - Intergenic
979178570 4:117696301-117696323 AGTACTGTGTGGATTATGGCTGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980377328 4:131967149-131967171 AATTATCTGGGCATGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980734977 4:136872888-136872910 AGTTTTTTGTTTATTATGGCTGG - Intergenic
981011707 4:139931868-139931890 AATTAGTTGGGCATGATGGCTGG + Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
982365871 4:154577802-154577824 AATTAATTGGGGATGAGGGCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982608728 4:157546767-157546789 AGTTAGCTGAGCATGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983041444 4:162932543-162932565 AGTCATTTTTAGATGAAGGCTGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984233551 4:177129890-177129912 GGTTCATTGTGGGTGATGGCAGG + Intergenic
984902072 4:184594262-184594284 AGTTATATGTGGATTTTGGCTGG - Intergenic
985294393 4:188419489-188419511 AGTTATTCGGGCATGGTGGCAGG + Intergenic
985608753 5:873987-874009 TGTTACTTGTGGATAATGGCCGG - Intronic
985987455 5:3528292-3528314 ACTTATCTGTGCATGGTGGCAGG + Intergenic
986447918 5:7839012-7839034 AGTTCTGTGTGGATGATGTGTGG + Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
991493042 5:67201914-67201936 AATTAGTTGGGTATGATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993276875 5:85871298-85871320 AGTTATTTGATGATGCTGGTGGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994197869 5:96939360-96939382 AATTATTTGGGCATGGTGGCGGG - Intronic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994595958 5:101835208-101835230 AGTTAGCTGGGCATGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994912583 5:105931509-105931531 AATTAGTTGGGCATGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996599951 5:125251528-125251550 GATTATTTGAGGATGATGGTTGG + Intergenic
996912226 5:128668945-128668967 AATTATCTGTGGGTGATGGCAGG - Intronic
997511433 5:134457522-134457544 AGTTAGCTGGGCATGATGGCGGG + Intergenic
999145574 5:149391113-149391135 AATTAGCTGGGGATGATGGCAGG - Intronic
999568958 5:152897103-152897125 TGTGATTTGAGGATGGTGGCAGG - Intergenic
999686588 5:154108484-154108506 AGTTAGTTGGGCATGGTGGCGGG + Intronic
999692292 5:154158571-154158593 ACTTATGTGTGGATGATTGCAGG - Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001629077 5:173161135-173161157 AGATATTTATGGATGATGTCTGG - Intronic
1002676057 5:180913789-180913811 AGTTATTCGTAGAGAATGGCAGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003799213 6:9643268-9643290 AATTAGTTGGGCATGATGGCAGG + Intronic
1004298584 6:14436644-14436666 AGTTATCTGTGGAGACTGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005393452 6:25356886-25356908 AGTTTTTAGTGAATGATGGTGGG + Intronic
1005451187 6:25974268-25974290 GGTTATTTCTGGCTGTTGGCTGG + Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006017388 6:31092779-31092801 AATTAGTTGGGCATGATGGCGGG + Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006283106 6:33071906-33071928 AGATATTTGTGGATTATGGGTGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008444146 6:51569062-51569084 AGCTAGCTGTGGGTGATGGCTGG - Intergenic
1008954235 6:57197889-57197911 AATTAGCTGTGCATGATGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010408011 6:75527694-75527716 AGTGAGTTGTGGCTGATGGATGG - Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013215486 6:108023686-108023708 AGTTTGCTGAGGATGATGGCAGG - Intergenic
1013358956 6:109375466-109375488 AATTAGTTGGGCATGATGGCAGG + Intronic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014895649 6:126896546-126896568 AGTTATTTGGGGATGATGGTAGG - Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015862089 6:137691813-137691835 AGTTATCTGTGGATGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016499250 6:144700714-144700736 AGTTAGTTGGGTGTGATGGCAGG - Intronic
1016528010 6:145024620-145024642 AATTAGTTGGGTATGATGGCGGG + Intergenic
1016594548 6:145784852-145784874 AGTTATTTGTGGATGACAGCAGG - Intergenic
1017154197 6:151308359-151308381 AGTTAGCTGGGCATGATGGCAGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019087343 6:169490975-169490997 TGTTTTTTGTGGATGATGAGTGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021180874 7:17504358-17504380 AATTATCTGGGCATGATGGCAGG - Intergenic
1021692216 7:23241724-23241746 AGAAAAATGTGGATGATGGCCGG - Intronic
1021885937 7:25139282-25139304 TATTATTTCTGGATGATGGATGG + Intronic
1022471424 7:30683823-30683845 AGGTTTATGTGGAGGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026076340 7:67173289-67173311 ACTTATTTGTGGAAGAAGGTGGG + Intronic
1026700517 7:72638993-72639015 ACTTATTTGTGGAAGAAGGTGGG - Intronic
1026771234 7:73201149-73201171 AGTTAGCTGGGCATGATGGCGGG + Intergenic
1027012102 7:74754546-74754568 AGTTAGCTGGGCATGATGGCGGG + Intronic
1027075939 7:75191508-75191530 AGTTAGCTGGGCATGATGGCGGG - Intergenic
1027465789 7:78513404-78513426 AGTTATTTCTGGCTGAGGACTGG - Intronic
1030152626 7:106422014-106422036 AGTTATTTGAGAATGAAAGCAGG + Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032411690 7:131698287-131698309 AGCTAATTGAGGATGGTGGCAGG - Intergenic
1032827910 7:135590258-135590280 AGTTAGCTGGGCATGATGGCGGG - Intronic
1033117608 7:138639476-138639498 AGTTATTTGGGCGTGGTGGCGGG + Intronic
1033337110 7:140463168-140463190 GGGTTTTTGTGGATGATAGCAGG - Intronic
1036405410 8:8450484-8450506 ACTTAGTTGGGCATGATGGCAGG + Intergenic
1036456069 8:8909109-8909131 AATTAGTTGTGCATGGTGGCAGG - Intergenic
1036806209 8:11836002-11836024 AGTTAGTTGGGCATGGTGGCAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039648771 8:39317551-39317573 AATTATCTGTGCACGATGGCGGG - Intergenic
1039705219 8:39999610-39999632 AATTAGTTGTGCATGTTGGCAGG - Intronic
1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043878263 8:85510839-85510861 AGTTAGCTGGGCATGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044231818 8:89787484-89787506 AATTATTTCTGGCTGAAGGCTGG + Intronic
1044565987 8:93661671-93661693 AGTTATCTGGGCATGGTGGCAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045689680 8:104747359-104747381 AGTTAGTTGGGCATGGTGGCGGG + Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046726887 8:117685422-117685444 AGTTACTTATGTATCATGGCAGG + Intergenic
1047453625 8:124989283-124989305 AGTTATCTGTGGATGATAGCAGG - Intergenic
1047934942 8:129767302-129767324 AGTTAGGTGTGGTTGCTGGCTGG - Intronic
1048412756 8:134192412-134192434 AGCTATTTCTGGTTGTTGGCAGG - Intergenic
1049511550 8:143029361-143029383 ATTTATTTGTTGATGCTGCCTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051743315 9:20272317-20272339 AGTTCTCTCTGGATGATGGTAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052178190 9:25490714-25490736 AATTAGCTGGGGATGATGGCAGG - Intergenic
1052591584 9:30503399-30503421 AGTTATCTGGGCATGGTGGCAGG + Intergenic
1053143071 9:35693461-35693483 AGTTATCTGGGCATGGTGGCGGG - Intergenic
1053642324 9:40097524-40097546 AATTATCTGGGCATGATGGCAGG - Intergenic
1053726579 9:41008059-41008081 AATTATTTGTGCATGGTGACAGG + Intergenic
1053763814 9:41367941-41367963 AATTATCTGGGCATGATGGCAGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054323214 9:63694916-63694938 AATTATCTGGGCATGATGGCAGG - Intergenic
1054339360 9:63843737-63843759 AATTATTTGGGCATGGTGGCAGG - Intergenic
1054542429 9:66279120-66279142 AATTATCTGGGCATGATGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058007038 9:99927621-99927643 AATTATCTGGGCATGATGGCAGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058167287 9:101634182-101634204 AGTTAGTTGGGAATGGTGGCGGG + Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058919141 9:109596740-109596762 AGGTATTTGTTGCTGAAGGCCGG + Intergenic
1059893366 9:118831640-118831662 AGTTATCTGTGCAGGATGACAGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202790102 9_KI270719v1_random:80561-80583 AATTATCTGGGCATGATGGCAGG - Intergenic
1185583625 X:1229090-1229112 AGTTCTTTGTTGCTGTTGGCCGG + Intergenic
1185950693 X:4429903-4429925 AGTTAGTTGGGGATGGTGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186860205 X:13665579-13665601 AATTAGCTGTGCATGATGGCGGG + Intronic
1187411188 X:19051770-19051792 AGTTATTGCTGGCTGTTGGCTGG - Intronic
1187446278 X:19364029-19364051 AGTGCTTGGTGGATGTTGGCAGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188240379 X:27780326-27780348 ATTTACTTTTGGATGATGGATGG - Intergenic
1188331762 X:28881249-28881271 AGTTATTTCTGATTGCTGGCAGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189383067 X:40515696-40515718 AATTAGTTGGGCATGATGGCAGG + Intergenic
1189937292 X:46082798-46082820 AATTAGTTGGGCATGATGGCAGG - Intergenic
1190601542 X:52097865-52097887 AATTATCTGAGGATAATGGCAGG + Intergenic
1191032201 X:55986847-55986869 TGTTATTTGAGAGTGATGGCTGG - Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1192172838 X:68867554-68867576 AGTCCTTTGTGGGTGAAGGCTGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192793572 X:74408069-74408091 AATTATCTGGGCATGATGGCGGG - Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193200328 X:78682324-78682346 ATTGATTGGTGGATGATGGATGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194482720 X:94446534-94446556 AATTATCTATGGATTATGGCAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1194870718 X:99127835-99127857 AGTTATCTGTGGATTACGGCAGG - Intergenic
1194976412 X:100401276-100401298 AGTGGTATATGGATGATGGCTGG - Intronic
1195412886 X:104587860-104587882 AGTTACTTGTGGCTGCTGGCTGG - Intronic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199580347 X:149354143-149354165 AGTTACCTGTGAATGATGGCAGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1199718908 X:150527748-150527770 AGTTATTTTTGGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201371151 Y:13266034-13266056 ATTGATTTGTGTATGTTGGCCGG + Intronic
1201376236 Y:13323245-13323267 AATTAGTTGGGCATGATGGCAGG + Intronic
1202350737 Y:23987783-23987805 AGTTAGATGGGCATGATGGCAGG - Intergenic
1202520042 Y:25682337-25682359 AGTTAGATGGGCATGATGGCAGG + Intergenic