ID: 901447972

View in Genome Browser
Species Human (GRCh38)
Location 1:9319647-9319669
Sequence GCTGGTGCAGAGGATGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901447966_901447972 -2 Left 901447966 1:9319626-9319648 CCGGGCTGGTATTCCGTTCCGGC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG 0: 1
1: 0
2: 7
3: 69
4: 527
901447964_901447972 3 Left 901447964 1:9319621-9319643 CCGTACCGGGCTGGTATTCCGTT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG 0: 1
1: 0
2: 7
3: 69
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901447972 Original CRISPR GCTGGTGCAGAGGATGCTGC GGG Intronic
900456644 1:2778124-2778146 GCTGCTGCAGGGCAGGCTGCTGG - Intronic
900693485 1:3995721-3995743 GCTGGCTCAGAGGAGGCTGATGG + Intergenic
900920594 1:5667864-5667886 GCTGGTGCAGGGGAGGGAGCTGG - Intergenic
900920626 1:5667996-5668018 GCTGGTGCAGGGGAGGGAGCTGG - Intergenic
901171806 1:7264246-7264268 CCTGGTGCAGCTGATGCTGCTGG + Intronic
901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG + Intronic
901471538 1:9460078-9460100 GCTGGTGCAGAGGAGGAAGCCGG - Intergenic
902235855 1:15056978-15057000 TCTGGTGCATTGGCTGCTGCTGG - Intronic
902395835 1:16132142-16132164 GCTGTTGACGAGGATGTTGCGGG + Exonic
902622097 1:17656547-17656569 GCTGTAGAGGAGGATGCTGCGGG - Exonic
903382702 1:22908062-22908084 GCTGTTGACGAGGATGTTGCGGG - Exonic
904277409 1:29393478-29393500 GCTGGGACAGAGGCTGTTGCAGG + Intergenic
904439250 1:30519169-30519191 GATGATGGAGAGGATGCTGATGG + Intergenic
904442544 1:30541044-30541066 GGTGGTGCTGGTGATGCTGCTGG + Intergenic
904521684 1:31100782-31100804 GCTGGTGCAGAGGACTGGGCAGG - Intergenic
904998623 1:34650758-34650780 GCTGGAGCTGAGGAAGCAGCAGG + Intergenic
905090067 1:35423569-35423591 GCTGCTTCAGAGGCTGATGCAGG + Intergenic
905249481 1:36638758-36638780 CCTGGAGGAGAGGATGCTGAAGG - Intergenic
905301462 1:36988953-36988975 GCTGGTGGAGAGGGGGCGGCGGG + Intronic
905544701 1:38788348-38788370 GCTGATGGAGAGGATGCTCAGGG - Intergenic
905923663 1:41735009-41735031 GCTGTTGCAGAGCATGTTGGTGG - Intronic
906166334 1:43689207-43689229 GATGGGGCAGAGAATGCTGGGGG - Intronic
906253354 1:44328670-44328692 CCAGGTGATGAGGATGCTGCTGG + Intronic
906815698 1:48876023-48876045 CCTTGTGCAGAGGCTGCTCCAGG - Intronic
907254252 1:53166438-53166460 GCAGGTGCTGAGGAGGCAGCAGG - Intergenic
907289538 1:53403914-53403936 GCTTGTGCTGAGCATGCTGAGGG - Intergenic
907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG + Intronic
907335820 1:53698727-53698749 CCTGGTGGAGAGGTGGCTGCAGG - Intronic
907497109 1:54852516-54852538 CCTGGTGAAGAAGATGGTGCAGG + Intronic
907883643 1:58574167-58574189 GCTGGTGGAGTGGATACTGTGGG - Intergenic
908683283 1:66686215-66686237 GCTGGAGCAGTGGAAGCAGCTGG - Intronic
910813541 1:91263790-91263812 CCTGGTGTAGAAGTTGCTGCTGG - Intronic
911152737 1:94610721-94610743 GCTGTTGCAGAGGCTGAGGCAGG - Intergenic
912480373 1:109978219-109978241 GGTGGTGCGGAGGCTGCTGCGGG - Intergenic
914954903 1:152153116-152153138 GCTGGAGCATTGGATGCTCCTGG + Intergenic
915304866 1:154971262-154971284 GCTGTAGCAGAGGATGCTAATGG - Intronic
917677889 1:177337694-177337716 GTGTGTGCAGAGGATGGTGCAGG - Intergenic
917786640 1:178466012-178466034 GCAGATGCAGAAGCTGCTGCTGG + Exonic
918418885 1:184341528-184341550 GCCTGAGCAGAGGATGCTGGTGG - Intergenic
920556748 1:206909724-206909746 GCTCGTGGAGCGGACGCTGCAGG - Exonic
921028486 1:211313567-211313589 GCTGGAGTGGAGGAGGCTGCCGG - Exonic
922200251 1:223394660-223394682 GCAGCTGCAGAGGAGGCTGGTGG + Exonic
923018206 1:230143072-230143094 GCTGGTGAAGAGAATGGTGCTGG + Intronic
1063148947 10:3320033-3320055 GCAGGTGCAGAGGGTGCGCCGGG - Intergenic
1063796404 10:9517949-9517971 GCTGGTGCACAGGATGCCTGTGG - Intergenic
1064293513 10:14056605-14056627 GCTGGGACAGAGGATGCGACTGG - Intronic
1065214655 10:23438722-23438744 GCGGCTGCAGTGGATGCTGCGGG - Intergenic
1065538639 10:26739121-26739143 GCTGGTGCAGGGGCTGGTGATGG - Intronic
1065920319 10:30387318-30387340 GCTGGGGCAGAGGACGGTGTGGG - Intergenic
1067187567 10:44043611-44043633 GCCCGGGCAGAGGATGCTGCAGG - Intergenic
1067453234 10:46395170-46395192 GCAGGTGCTGTGGATGCTGCTGG - Intergenic
1067549909 10:47227006-47227028 CCTGCTGCAGAGAATGCAGCGGG - Intergenic
1067562105 10:47311364-47311386 GCTGCTGCAGAGCAGGCTGCAGG - Intronic
1067584001 10:47464596-47464618 GCAGGTGCTGTGGATGCTGCTGG + Intronic
1067730728 10:48809448-48809470 GCTGGTGGTGAAGATGCTGATGG - Intronic
1067755544 10:49001767-49001789 GCGGGAGCAGAAAATGCTGCCGG + Intergenic
1067771587 10:49130545-49130567 TGTGGGGCAGGGGATGCTGCTGG + Intergenic
1069682989 10:70298599-70298621 CCTGGTGCTGCGGATGCTGCTGG + Intergenic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070695361 10:78559303-78559325 GCTGGTGCAGAAAATACAGCTGG - Intergenic
1070731427 10:78831261-78831283 GCTGGAGCAGAAGATCCTGGGGG + Intergenic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1071466247 10:85942333-85942355 CCTGGTTCAGAGGATGTTGGTGG + Intronic
1071481855 10:86070539-86070561 GCTGGTGAAGGGAATCCTGCAGG + Intronic
1071482889 10:86078454-86078476 GCTTGTGGAGAAGCTGCTGCAGG - Intronic
1073044218 10:100626969-100626991 GCTGGGGCAGAGGGTGTTGGGGG + Intergenic
1074107959 10:110402494-110402516 GGTGGTGGAGAGGATACTTCAGG - Intergenic
1074134642 10:110615946-110615968 AATGGTGCTGAGGATGCTGGTGG - Intergenic
1074208708 10:111308163-111308185 GCTGGAGGAGAGCATGATGCTGG + Intergenic
1074253466 10:111777085-111777107 GGTGGTACAGTGGATTCTGCAGG + Intergenic
1074465605 10:113679183-113679205 GCTGGTGGAGATGCTGCTCCTGG - Intronic
1074535860 10:114328351-114328373 GCTGCTGCAGGTGCTGCTGCAGG + Intronic
1075428943 10:122364646-122364668 GCTGTTGCAAAGGGTGCTGTTGG - Intergenic
1075429460 10:122368498-122368520 GCTGGTGCAGAGATGGCTGCTGG + Intergenic
1075798093 10:125135252-125135274 GGTGGTGGAGCGGGTGCTGCAGG - Intronic
1076482645 10:130794859-130794881 GCAGGTGCACAGGATGGTGCAGG + Intergenic
1076601671 10:131660758-131660780 CCTGGTCCTGAGGTTGCTGCTGG - Intergenic
1076659268 10:132044510-132044532 GCCGGTGCAGAGGAGGATGCAGG + Intergenic
1076687334 10:132204047-132204069 ACTGGGGCAGGAGATGCTGCTGG + Intronic
1076704506 10:132293838-132293860 GCTGGGGCAGAGCCTGCTCCGGG + Intronic
1076886388 10:133264713-133264735 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886404 10:133264793-133264815 GGTGGGGCAGAGGCTGCAGCAGG - Intronic
1076886415 10:133264833-133264855 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886423 10:133264872-133264894 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886432 10:133264912-133264934 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886439 10:133264952-133264974 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886447 10:133264991-133265013 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886457 10:133265031-133265053 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886466 10:133265071-133265093 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886474 10:133265110-133265132 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886483 10:133265150-133265172 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886492 10:133265190-133265212 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886501 10:133265230-133265252 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886511 10:133265270-133265292 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076921946 10:133458874-133458896 GCTGATGCAGAGGAGGGTGGGGG + Intergenic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1077394730 11:2315349-2315371 GCTGGCGCTGAGGATGGTGCTGG + Intronic
1077648804 11:3951097-3951119 GCTTGTGCAGAGGAGGGAGCAGG + Intronic
1077940371 11:6834391-6834413 GCTGGTGGAGAGGATTGTGGAGG - Intergenic
1078643226 11:13115100-13115122 GCTGGAGCAGAAGCTGCTGGGGG - Intergenic
1078726016 11:13931609-13931631 GCTGGTGCAGCTGCTGCTGCAGG + Intergenic
1079024301 11:16933949-16933971 GCTGATGCAGAGGATGGGGCTGG - Intronic
1079803203 11:24896544-24896566 GCTGGGGCATGGGAGGCTGCAGG - Intronic
1080641483 11:34160992-34161014 GGTGGTGCAGAGCCTCCTGCGGG - Exonic
1080655188 11:34252805-34252827 GCTGGGCCAGAGGAGGCTGGGGG + Intronic
1080791488 11:35525846-35525868 GCGGCTGCAAAGGAAGCTGCGGG + Intronic
1082629298 11:55522168-55522190 GTTGGTTCTGAGGATGATGCTGG + Intergenic
1083303125 11:61749095-61749117 GCTGGGGCAGAGGCTGGGGCAGG - Intergenic
1083332750 11:61906517-61906539 GGCGGGGCAGAGGGTGCTGCTGG + Exonic
1083743248 11:64722176-64722198 GCAGGGGGAGAGGAAGCTGCAGG - Intronic
1083931600 11:65849377-65849399 GCTGCTGAAGAGGGTTCTGCAGG + Intronic
1084182138 11:67452133-67452155 GCTGTCGCTGAGGATGCTGGAGG - Exonic
1084209176 11:67613088-67613110 GCTGGCCCAGAAGACGCTGCTGG - Intergenic
1084421048 11:69060761-69060783 GGAGGTGCTGAAGATGCTGCTGG - Intronic
1084472570 11:69371805-69371827 CCTGGTGCTGAGGCTGCTGCTGG - Intergenic
1084907268 11:72357792-72357814 GCTGTTGGAGAGGGTTCTGCTGG + Intronic
1085574554 11:77590301-77590323 GATGATGCAGATGATGCTGGGGG + Exonic
1085580716 11:77647705-77647727 GCTGGTGCTGAAGAAGCTACTGG + Intergenic
1086324618 11:85685809-85685831 GCTGGAGGAGAAGATGATGCAGG - Exonic
1086865135 11:91971374-91971396 CCTGGTGATGCGGATGCTGCTGG - Intergenic
1087729736 11:101765220-101765242 TCTGGAGCAGAGGCTGCTGGAGG - Intronic
1089255169 11:117190309-117190331 GCTGGAGCTGAGGCTGCGGCAGG - Intronic
1089502655 11:118941313-118941335 GCTGGGCAAGAGGATGCTGAAGG - Intronic
1091750734 12:3019961-3019983 GCCGGTGGAGAGGCTGCTGCAGG - Intronic
1091918070 12:4283279-4283301 GCTGGTGCCGGGGCTGCGGCTGG + Intronic
1091919717 12:4294434-4294456 GCTGGTGCTTTGGAGGCTGCAGG + Intronic
1092210252 12:6641241-6641263 GCTAGTGCTGAGGAAGCTGAGGG - Intronic
1092666573 12:10806575-10806597 GGTGGTGCACTGGATCCTGCTGG - Exonic
1093548014 12:20369893-20369915 GCTGGTGCTGAGGCTGAGGCTGG + Exonic
1095143528 12:38696167-38696189 ACTGGTGTAGAGGAAGATGCTGG - Intronic
1096675940 12:53225930-53225952 GCTGGAGGAGAGGATGCTTCTGG + Intronic
1096968075 12:55644422-55644444 GCAGGTGCTGAGGCTGCTGCTGG - Intergenic
1097180625 12:57169732-57169754 GCTTGAGAAAAGGATGCTGCAGG + Intronic
1098227979 12:68344479-68344501 GCTGGAGCAGAGGAAGCTTTGGG + Intergenic
1099070152 12:78036215-78036237 GCTGCTGCAGTGGATGCTGCTGG - Intronic
1100006012 12:89896412-89896434 GCTGGTGCAGAGGTTGTGGTGGG + Intergenic
1102513188 12:113429248-113429270 GGTGGTGCAGAGGCTGCAGGGGG + Exonic
1103713541 12:122929982-122930004 GCTGGTGCAGCGGCAGATGCTGG - Exonic
1103928226 12:124435476-124435498 GCTGGTGCCTGGGAAGCTGCGGG - Intronic
1104315544 12:127696792-127696814 GGTGGTGGAGAGGATGGTGGTGG + Intergenic
1106019328 13:25899691-25899713 GTTGGTGCAGGGGAGGGTGCAGG + Intronic
1106593243 13:31115770-31115792 GCTCGTGCTGAGGTTGGTGCTGG + Intergenic
1107205347 13:37778894-37778916 ACTGATTCAGAGGATGTTGCAGG - Intronic
1107415967 13:40200413-40200435 CCTAGAGCAGGGGATGCTGCAGG - Intergenic
1107560095 13:41550700-41550722 GCAAGTGCAGAGGATGCAGGAGG - Intergenic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1109797215 13:67331603-67331625 GCTAGAGCAGAGGATGGGGCGGG - Intergenic
1110407871 13:75170561-75170583 TCATGTGGAGAGGATGCTGCTGG + Intergenic
1111707540 13:91769627-91769649 GGTGATGCAGATGATGCTGGAGG + Intronic
1113180150 13:107615599-107615621 GCTGGTTCAGAGGAAGTGGCTGG - Intronic
1113416521 13:110132663-110132685 GCCAGTGCACAGGAGGCTGCAGG + Intergenic
1113835490 13:113326014-113326036 GCTGGTGCGGGCGAAGCTGCCGG - Exonic
1113848111 13:113403784-113403806 GCTGAGGGAGTGGATGCTGCTGG - Intergenic
1114267987 14:21083870-21083892 GCTGTTCCAGAGGCTGCTGCAGG - Exonic
1117046982 14:51823013-51823035 GCTCGTGCAGAGGATGGTGTTGG + Intergenic
1118514309 14:66508867-66508889 GCCGGTGCGGAGGGCGCTGCGGG + Intronic
1118612987 14:67555833-67555855 GCTGGAGCAGAGGCTGCTGGAGG + Exonic
1118930985 14:70240196-70240218 TCTGGTACAGAAGATGCTGGTGG - Intergenic
1119180315 14:72600830-72600852 GCTGGTGGTGGGGATGCGGCAGG - Intergenic
1119399979 14:74356801-74356823 GCTGGTGCAGAAGGTGCTGCAGG + Exonic
1121261358 14:92568723-92568745 CCTGGGGCAGAGGAGGCTGGAGG - Intronic
1121439445 14:93939650-93939672 GATCGTGCAGATGCTGCTGCCGG - Exonic
1121498145 14:94411795-94411817 GCTGGGGCTGAGCAAGCTGCTGG + Intergenic
1121640234 14:95480422-95480444 GCTGGGGCAGATGATGTGGCAGG + Intergenic
1121693699 14:95895688-95895710 TCTGGTGCATAGGGTGCTGGGGG - Intergenic
1122020078 14:98830502-98830524 GCTGGTGGAGAGGGCACTGCAGG - Intergenic
1122039386 14:98973016-98973038 GCTGGTGCAGACGAAGCGGCGGG - Intergenic
1122212557 14:100182061-100182083 GCTGGAGCAGAGGATGCTGGAGG + Intergenic
1122519593 14:102334071-102334093 GGTGGTGCAGAGGATGGGGCAGG - Intronic
1122920019 14:104876164-104876186 GCTGGGGCAGGGGATGGAGCAGG + Intronic
1123762157 15:23441442-23441464 GCGGGAGCAGAAGAAGCTGCGGG - Exonic
1123995131 15:25713097-25713119 GGTGGAGGTGAGGATGCTGCAGG - Intronic
1124107802 15:26756878-26756900 GCTGGTGCAGAAGAATCTCCAGG - Intronic
1124229903 15:27935493-27935515 GCCTGTGCGGAGGAGGCTGCTGG - Intronic
1124971184 15:34490700-34490722 GCTGGAGCAGAGGCAGCAGCGGG - Intergenic
1125479541 15:40070531-40070553 GCAGGTGCAGAAGCTGGTGCCGG - Intergenic
1125550510 15:40541126-40541148 GCAGCTGCAGCGGATGCTTCTGG + Intronic
1126098563 15:45106196-45106218 CCTGCTGCAGAGGCTGCAGCTGG + Exonic
1127389787 15:58496196-58496218 GCTGGAGAAGAGGATGTTACTGG + Intronic
1128738276 15:70065981-70066003 GCTGGGGCAGAGGGTGGGGCGGG - Intronic
1128859340 15:71052457-71052479 GCTGAGTCAGAGGATGGTGCTGG + Intronic
1129210167 15:74063835-74063857 GCAGGTGCAGAGCATCCTACTGG + Intergenic
1129263291 15:74380939-74380961 GCAGGGGCAGAGGAAGCTGGTGG - Intergenic
1129403855 15:75301567-75301589 GCAGGTGCAGAGCATCCTACTGG - Intergenic
1129405336 15:75313236-75313258 GCTGGAGCAGAGGACGGTGTGGG + Intergenic
1129478994 15:75808161-75808183 GCTGGGGCAGAGGACGGTGTGGG + Intergenic
1130901563 15:88210577-88210599 GCCTGTGAAGATGATGCTGCTGG + Intronic
1131177524 15:90219480-90219502 GCTTCTGAAGAGGATGCTGCTGG + Intronic
1132513195 16:353926-353948 GCTGGTGCTGGGGCTGCTGCTGG - Intergenic
1132584889 16:701812-701834 GCTGAGGCTGAGGATGGTGCAGG - Intronic
1132701273 16:1223125-1223147 GCTGGTGTCGGGCATGCTGCTGG - Intronic
1133823818 16:9259845-9259867 GGTGATGAAGAGGATGCTGTAGG - Intergenic
1135345476 16:21685247-21685269 GCTGGTGCAGACGCTGCTCCAGG - Exonic
1135539176 16:23316830-23316852 GATGGTGCTGAGGATGATGATGG - Intronic
1136223642 16:28844651-28844673 GCTGCTGCAGAGGGTGGGGCTGG - Intronic
1137250284 16:46736306-46736328 GCCTGTGCAGAGGATCCTGCCGG - Intronic
1137290242 16:47047569-47047591 GCTGGTGCTGAGGAGTTTGCAGG - Intergenic
1137723162 16:50639600-50639622 GCTGCAGCAGAGGATGAGGCTGG + Exonic
1138282280 16:55781042-55781064 GCTGATGGACAGGATGCAGCGGG + Intergenic
1138408194 16:56815895-56815917 GCTGGTGCTGCTGCTGCTGCTGG + Intronic
1138943709 16:61821844-61821866 ACTGGTGTAGAGGAAGCTGTTGG + Intronic
1139893498 16:70269711-70269733 GTTGGTGCTGAGGATGCCGATGG - Exonic
1140014758 16:71171099-71171121 GCTGGAGCAGAGGAAGCTGTTGG - Intronic
1140455946 16:75105614-75105636 GCTGGTGCAGAGGAGGCTTAAGG + Intronic
1141860147 16:86710871-86710893 GGTGGGGCAGAGGAGGCTGGAGG + Intergenic
1142108400 16:88318408-88318430 GCTGGGGCAGAGGACACCGCTGG - Intergenic
1142200284 16:88757851-88757873 GCTGGAGCTGAGGCTGCTGGGGG - Intronic
1142504924 17:357208-357230 CCTGGATCAGAGGATGGTGCCGG - Intronic
1143164162 17:4889661-4889683 GCGGGAGCAGCGGAAGCTGCAGG + Exonic
1143210195 17:5180553-5180575 GCTGGTGCAGTGGCTCATGCCGG + Exonic
1143544460 17:7588305-7588327 CCTGGGGTAGGGGATGCTGCTGG + Exonic
1143675690 17:8430850-8430872 GCTGGGGCAAAGGTTGCTGATGG + Intronic
1144230728 17:13200568-13200590 TCTGGTGAAGAGGAGGCTCCTGG + Intergenic
1145209784 17:21004484-21004506 GCTGATGCACAGGAGGCTGCAGG + Intronic
1145772122 17:27500805-27500827 GCGGGGGCAAAGGGTGCTGCTGG + Intronic
1146730184 17:35186418-35186440 GCTGGTGGAGAGTGAGCTGCTGG + Exonic
1147132122 17:38415681-38415703 CCTGGTGCAGCTGAGGCTGCAGG - Intergenic
1147436937 17:40422244-40422266 GCTGCTGCAGAGGCTGAAGCAGG - Intergenic
1147661871 17:42121153-42121175 GCTGGGGCAGGGGCTGGTGCCGG + Exonic
1147686962 17:42291926-42291948 GCTGGAGCAGAGGATGGCGCTGG + Intronic
1147915561 17:43883277-43883299 GCTGGTGCAGGAGATCCTGCGGG - Exonic
1147959021 17:44154866-44154888 GACGGTGCACAGGTTGCTGCTGG + Exonic
1148165087 17:45477937-45477959 GCTGGGGCAGAGGCTTCTGGTGG + Exonic
1148278188 17:46325138-46325160 GCTGATGGGGAAGATGCTGCAGG - Intronic
1148300398 17:46542993-46543015 GCTGATGGGGAAGATGCTGCAGG - Intronic
1148382388 17:47209477-47209499 GCTGGTGCAGGGGCTGGAGCTGG - Exonic
1148382392 17:47209489-47209511 GCTGGGGCAGGGGCTGGTGCAGG - Exonic
1148807265 17:50270303-50270325 GCTAGAGCAGAGCATTCTGCTGG + Intergenic
1148899175 17:50863288-50863310 GCTGTTGCTGTGGCTGCTGCTGG + Exonic
1149329822 17:55569239-55569261 GCTGGTGCATACCATGCTCCTGG + Intergenic
1150396319 17:64824662-64824684 GCTGGGGCAGAGGCTTCTGGTGG + Intergenic
1150423143 17:65056431-65056453 GCTGGTGAAGATCCTGCTGCTGG - Exonic
1150441582 17:65195880-65195902 CCTGGTGCTGCGGATGCCGCTGG - Intronic
1150564821 17:66329367-66329389 ACTGGGGCAGAGGGTGATGCCGG + Intronic
1151305749 17:73261831-73261853 GCTGGGGCTGCGGAAGCTGCTGG + Exonic
1151411058 17:73930022-73930044 GCCAGTGCAGAGGATGCGGGTGG + Intergenic
1151834164 17:76572525-76572547 CCTGGTCCAGTGGATGCTGAGGG - Intronic
1152086649 17:78223738-78223760 GCCTGTGCAGCGGGTGCTGCTGG + Exonic
1152427780 17:80227860-80227882 GCTGGTGCTGAAGCTGATGCGGG + Exonic
1152625328 17:81385557-81385579 GCTGGGGGAGGGGATGCAGCTGG - Intergenic
1153544536 18:6192468-6192490 GCAGGTGCAGCGGGTGGTGCTGG + Intronic
1153566364 18:6422183-6422205 GCTGATGCAGAAGCTGCAGCAGG - Intergenic
1154412939 18:14151101-14151123 CCTGGGGCAGAGGATCCTGGAGG - Intergenic
1155683747 18:28521196-28521218 GCTGGGGCAGTAGATGATGCTGG + Intergenic
1155881189 18:31150470-31150492 GATGGTGCTGATGATGATGCTGG - Intronic
1156036159 18:32770321-32770343 GCTGCTGCGGCGGCTGCTGCTGG + Exonic
1157280768 18:46345063-46345085 GCTGATGCTGAGGCTGCTTCGGG + Intronic
1157557321 18:48621400-48621422 GCTGGAGCAGAGGATGAGGGAGG + Intronic
1157764375 18:50285913-50285935 GCTGCTGCTGGTGATGCTGCAGG + Exonic
1158670408 18:59469007-59469029 GCTGGTGCCGTGGATGGTGCAGG + Intronic
1160119845 18:76120556-76120578 ACTGTTCCAGGGGATGCTGCTGG - Intergenic
1160169965 18:76544783-76544805 GCTGGTGCAGAAGAGGCAGGGGG + Intergenic
1160736523 19:665111-665133 GCTGGTGCAGGGGCTGCGTCTGG - Intergenic
1160796314 19:947343-947365 GTTGGTGCAGAGGAGGCAGGAGG - Intronic
1162019098 19:7860608-7860630 GCTGGAGCAGTCGAGGCTGCGGG + Exonic
1162042718 19:7980215-7980237 GTGGGTGCAGTGGCTGCTGCAGG + Intronic
1162063270 19:8109674-8109696 GCAGCTGCAGAGGTAGCTGCCGG + Exonic
1162186746 19:8911060-8911082 GATGGTGATGAGGATGATGCAGG - Intronic
1162186756 19:8911209-8911231 GATGGTGATGAGGATGATGCTGG - Intronic
1162302972 19:9854635-9854657 GCTGGTGCAGAGGAGCCTCCCGG - Exonic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163053969 19:14705062-14705084 GCTGTTCCTGAGGATGCAGCTGG + Exonic
1163130561 19:15270157-15270179 GCAGGTGGAGAGGCTGTTGCAGG + Intronic
1163585634 19:18161996-18162018 GCTGGTGGAGAAGCTGCTTCAGG + Exonic
1163719937 19:18894198-18894220 GGGAGTGCAGAGGAAGCTGCTGG + Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165289759 19:34873804-34873826 CCTGATGCGGAGGATGCAGCTGG + Intergenic
1165429908 19:35766761-35766783 GCTGGTGCCGGGGATGCTGTAGG - Exonic
1165850915 19:38849900-38849922 GCTGGAGCAGAGGCAGCAGCCGG - Exonic
1166016030 19:39980077-39980099 GGAGGTTCAGAGGATCCTGCTGG + Exonic
1166643311 19:44512802-44512824 GCTGGGGAAGAGGCTGGTGCTGG - Intronic
1167015552 19:46838710-46838732 CCTGGTGAAGAGGAGGCTGAAGG - Intronic
1167389187 19:49182826-49182848 GCATGTGCTGAGGATGCTGCTGG + Exonic
1167441356 19:49511039-49511061 GCTGGTTCAGAGTCTGATGCGGG - Intronic
1167621510 19:50563452-50563474 GATGGTGGAGGGGATGCTGCTGG + Intronic
1167631724 19:50629879-50629901 GCTGGTGGTGAGGATCCTGCAGG - Exonic
1168241893 19:55092737-55092759 GCTGGTGCAGAGGGTGGGCCGGG - Intronic
1168335945 19:55597831-55597853 GCTGGTGCAGGGGTTGGGGCGGG + Exonic
925164998 2:1710561-1710583 GCTAGTGGAGAGGGTGCTGGTGG - Intronic
925165002 2:1710576-1710598 GCTGGTGGAGAGGGTGCTAGTGG - Intronic
925165028 2:1710704-1710726 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165032 2:1710719-1710741 GCTGGTGGAGAGGGTGCTGGTGG - Intronic
925165036 2:1710734-1710756 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165040 2:1710749-1710771 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165048 2:1710781-1710803 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165052 2:1710796-1710818 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165060 2:1710828-1710850 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165064 2:1710843-1710865 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165079 2:1710907-1710929 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165093 2:1710969-1710991 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165097 2:1710984-1711006 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165105 2:1711016-1711038 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165109 2:1711031-1711053 GCTGGTAGAGTGGATGCTGGTGG - Intronic
925165133 2:1711144-1711166 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165141 2:1711176-1711198 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165145 2:1711191-1711213 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165153 2:1711223-1711245 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165157 2:1711238-1711260 GCTGGTAGAGTGGATGCTGGTGG - Intronic
925165171 2:1711302-1711324 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165175 2:1711317-1711339 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165183 2:1711349-1711371 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165187 2:1711364-1711386 GCTGGTAGAGTGGATGCTGGTGG - Intronic
925165207 2:1711460-1711482 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165211 2:1711475-1711497 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165219 2:1711507-1711529 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165223 2:1711522-1711544 GCTGGTGGAGTGGATGCTGGTGG - Intronic
925165233 2:1711571-1711593 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925165245 2:1711620-1711642 GCTGGTGGAGCGGGTGCTGGTGG - Intronic
925165249 2:1711635-1711657 GCTGGTGGAGTGGGTGCTGGTGG - Intronic
925247965 2:2401566-2401588 GCTGATCCACAGGATGCTGTAGG + Intergenic
925534919 2:4906181-4906203 GGTGGTGCAGAGGCTGAGGCAGG - Intergenic
926195792 2:10762913-10762935 GCTGGTGTGGAGGAGGCTCCAGG - Intronic
926253580 2:11170346-11170368 GCTGCTGAAGAGGCTGATGCTGG + Intronic
926339744 2:11895104-11895126 GCTGGTGCTGAGGATCTAGCTGG + Intergenic
926825154 2:16898850-16898872 ATTGGTGCAGGGGAAGCTGCAGG - Intergenic
927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG + Intronic
927491905 2:23526424-23526446 GCTGGTGCAGAGGGCTCTGCAGG + Intronic
927851564 2:26503231-26503253 GCTGCTGCAGAGGAGGCGGGAGG - Intronic
927917471 2:26946215-26946237 GCAGGAGAAGAGGAGGCTGCTGG - Intronic
927937512 2:27083968-27083990 GCTGGTGCAGACGGTCCTCCAGG - Exonic
929433612 2:41909558-41909580 GCAGGTCCAGAAGATCCTGCAGG + Intergenic
929790331 2:45017800-45017822 TGTGGGGCTGAGGATGCTGCGGG - Intergenic
929805913 2:45145007-45145029 GCAGGGGCAGAGGAAGCAGCTGG + Intergenic
929825201 2:45304579-45304601 GCAGGTGCAATGGAGGCTGCAGG + Intergenic
929931086 2:46256004-46256026 GAGGGTGCAGAGGCTGCTGCAGG - Intergenic
930781185 2:55225725-55225747 CCTGGAGGAGGGGATGCTGCAGG - Intronic
930825480 2:55693169-55693191 CCTGGTGAAGAGGAGGCTGAAGG + Intronic
931229283 2:60360425-60360447 GCTGGTGCAGCAGATTCAGCGGG + Intergenic
931681276 2:64751432-64751454 GCTGGTGGAGAGGAGGAGGCCGG - Intergenic
935147255 2:100404258-100404280 GCTGGTGGTGAGGATGCTGTTGG - Intronic
935582139 2:104765568-104765590 ACTGGAGCATAGGATGCTGTGGG + Intergenic
935815668 2:106843800-106843822 GCCGGTGCAGGGGAAGCAGCGGG - Exonic
936075905 2:109401736-109401758 GCTGGTGCAGGTGAGGATGCAGG - Intronic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936487952 2:112942718-112942740 GCAGGTCCAGAGGAAGCAGCAGG - Intergenic
937339904 2:121084507-121084529 AATGGTGGAGAGGAAGCTGCTGG + Intergenic
937956063 2:127422426-127422448 GCTGCTGCGGCGGCTGCTGCTGG - Intronic
938035987 2:128035389-128035411 GCTACTGCAGAGGATGATGTGGG - Intergenic
938111794 2:128572744-128572766 GCTTGTGCAGAGGAAGGTGGGGG + Intergenic
938186804 2:129239357-129239379 GCAGGTGCAGAGAATGCTGTTGG - Intergenic
938304376 2:130241506-130241528 AATGGTGCTGAGGATGCAGCTGG - Intergenic
938379193 2:130827171-130827193 CCTGGAGCAGGGGCTGCTGCGGG - Intergenic
938664792 2:133523754-133523776 GCTGGTGCGTTGGATGCTGCAGG - Intronic
942277926 2:174336249-174336271 GCTGGAGCCGAGGTTGCAGCTGG - Exonic
942324544 2:174764946-174764968 GCTGGTGTTGAGTCTGCTGCTGG + Intergenic
944416074 2:199481109-199481131 GCAGGTGTAGAGGGTGCTCCTGG + Intergenic
945710538 2:213289151-213289173 CCTGGTGCTGCGGTTGCTGCTGG + Intronic
946158422 2:217821763-217821785 GCTGGTGGAGAGGGGGCTGGGGG + Exonic
946301875 2:218828735-218828757 GCTGGTGTAGAGGAGGGTCCAGG - Intronic
946367918 2:219261681-219261703 GCTGGTTCAGAGGCTGCTGAAGG - Intronic
947149309 2:227098628-227098650 ACTGGTGCTGATGATGATGCAGG + Intronic
947224379 2:227826050-227826072 GCTGTTACAGAGGGTGGTGCAGG - Intergenic
947363742 2:229372729-229372751 GCTGGTTCAGAGGCTCCTGTAGG + Intronic
947706630 2:232281707-232281729 GGTGGTGCCGATGATGCTCCTGG - Intronic
947714133 2:232331355-232331377 GCGGGAGCAGTGGATGCTGATGG + Intronic
947733883 2:232445082-232445104 GCCGGTGCTGCGGAAGCTGCAGG + Intergenic
947908073 2:233780202-233780224 GCTGGGGTAGAGGATGTTGGAGG + Intronic
948130806 2:235599380-235599402 GCTGGGGAAGTGGATGCTGCAGG + Intronic
948298903 2:236887115-236887137 GTTGGTGCACAGGACACTGCTGG + Intergenic
948401583 2:237689573-237689595 GCTGCTGCAGAGGATGTAGGTGG - Intronic
948429686 2:237911680-237911702 GAAGGGGTAGAGGATGCTGCCGG - Exonic
948513225 2:238487256-238487278 GGTGGGGCTGAGGAGGCTGCAGG - Intergenic
948588267 2:239034825-239034847 GATGGTGCAGAGGAGGCAGGAGG - Intergenic
948714609 2:239852650-239852672 TGTGGGGCAGGGGATGCTGCAGG + Intergenic
1169226697 20:3861413-3861435 GCTGTTGTAGGGGATGCTGTGGG - Exonic
1169321264 20:4635072-4635094 GCAGGTGCAGGGGTTGCTGAGGG - Intergenic
1169486800 20:6041324-6041346 GCCCGTACAGAGGGTGCTGCCGG + Exonic
1170384536 20:15801320-15801342 GCTGGAGCAGAGGATGCTGGAGG + Intronic
1171816161 20:29787633-29787655 GCTGGTGCAGGGGAGGGAGCCGG + Intergenic
1171816168 20:29787665-29787687 GCTGGTGCAGGTGATGGAGCTGG + Intergenic
1172444134 20:34984445-34984467 GCTGGGGCAGAGGAGGCTGCAGG + Intronic
1172445816 20:34992951-34992973 GCTGGTGCAGAGGTTCCAGCAGG - Intronic
1172643437 20:36455434-36455456 TCAGGTGCAGAGAATGCAGCTGG - Intronic
1173163671 20:40671174-40671196 GCTGGTGGGGAGGATGGAGCAGG - Intergenic
1173347333 20:42213100-42213122 CCAGGTGAAGCGGATGCTGCTGG - Intronic
1173619273 20:44424229-44424251 CCTGTTGCAGGAGATGCTGCTGG + Exonic
1174503889 20:51004542-51004564 GCTGGTGCTGCGCGTGCTGCGGG - Exonic
1174548935 20:51347196-51347218 GCAGGTGCAGATGCTGATGCTGG + Intergenic
1174548943 20:51347316-51347338 GCAGGTGCAGATGCTGATGCTGG + Intergenic
1174548957 20:51347565-51347587 GCAGGTGTTGATGATGCTGCTGG + Intergenic
1175564051 20:59958774-59958796 GCTGCTGCTGTGGCTGCTGCAGG + Exonic
1175732267 20:61362039-61362061 GCTGGTGAAGAAGATGCAGAGGG + Intronic
1175995921 20:62812335-62812357 GCTGGTGCGGCGGGAGCTGCCGG + Exonic
1176008151 20:62877286-62877308 GCTGCTGCTGAGGATGCAGGTGG - Intergenic
1176131555 20:63498751-63498773 GCTGGGCCAGAGGACGCTGAGGG - Intronic
1176267782 20:64219792-64219814 GCTGCTGCAGCTGCTGCTGCTGG - Exonic
1176860071 21:14007151-14007173 CCTGGGGCAGAGGATCCTGGAGG + Intergenic
1178294011 21:31393439-31393461 GCAGAGGCAGAGGATGCTGCTGG - Intronic
1179085032 21:38208269-38208291 GCTGAGGCAGAGGCTGGTGCAGG - Intronic
1180614691 22:17119882-17119904 GCTGGTGGAGCTGATGCTGGAGG - Exonic
1180799509 22:18625224-18625246 TCTGGAGGAGAGGATGCTGAGGG + Intergenic
1180962763 22:19769684-19769706 GCTGTCACAGAGGAAGCTGCTGG - Intronic
1181085475 22:20437640-20437662 GCTGCTGCTCTGGATGCTGCCGG - Exonic
1181222207 22:21370042-21370064 TCTGGAGGAGAGGATGCTGAGGG - Intergenic
1181512358 22:23394618-23394640 GCTGATCCTGAGGCTGCTGCTGG + Intergenic
1181637966 22:24183035-24183057 TCTGGAGGAGAGGATGCTGAGGG - Exonic
1181949136 22:26541600-26541622 GTCGGTGCGGAGGGTGCTGCTGG - Exonic
1181985262 22:26796254-26796276 CTTGGGGCAGAGGAAGCTGCAGG - Intergenic
1182704708 22:32269906-32269928 GCTGGTGGTGAGGACGCTGGTGG - Intergenic
1183678528 22:39313283-39313305 GCTGGTGCAGACGAAGCGGCGGG - Exonic
1183776269 22:39968164-39968186 GCTGGTGCTGGTGCTGCTGCAGG - Exonic
1183850887 22:40586890-40586912 GCTGGTGCTGCTGGTGCTGCTGG + Intronic
1184925118 22:47631204-47631226 GCTGGTGCAGAGGGTGGGTCCGG + Intergenic
1185171852 22:49298948-49298970 GCGGGTGGAGAAGCTGCTGCGGG - Intergenic
1185171859 22:49298987-49299009 GCGGGTGGAGAAGCTGCTGCGGG - Intergenic
1185171866 22:49299026-49299048 GGTGGTGGAGAAGCTGCTGCGGG - Intergenic
1185364741 22:50432282-50432304 CCTGGTGCAGAGGATCCTGGAGG + Exonic
1185388737 22:50548008-50548030 GCTGGGGCAGGGGATGCGGCTGG - Intergenic
1185388758 22:50548056-50548078 GCTGGGGCAGGGGATGCGGCTGG - Exonic
950003254 3:9673908-9673930 GCTGATGCAGATGATGATGATGG + Intronic
950201767 3:11049573-11049595 TCTGGGGGAGAGGATGCTCCAGG - Intergenic
950604238 3:14064301-14064323 GCTGCTGCTGAGGATGCTTCTGG - Exonic
950604247 3:14064370-14064392 GCTGCTGCTGGGGCTGCTGCTGG - Exonic
950604253 3:14064397-14064419 GCTGCTGCTGTGGCTGCTGCTGG - Exonic
950604257 3:14064424-14064446 GCTGGTGGAGCTGCTGCTGCTGG - Exonic
950849721 3:16051181-16051203 GCTGGGGCATAGGATGCATCTGG - Intergenic
952974535 3:38682553-38682575 TCTGAAGCAGAGGATGATGCTGG - Intergenic
953390778 3:42532485-42532507 GCTGGAGCAGGGGATGGTGGTGG - Intronic
953512913 3:43561291-43561313 GCGGGTGAAGAGGAAGGTGCAGG - Exonic
954111117 3:48433706-48433728 TCTCGAGCACAGGATGCTGCAGG - Exonic
954292454 3:49656786-49656808 GCTGGTGCAGCGGGAGTTGCAGG + Exonic
954553738 3:51502744-51502766 GCAGGGGTAGAGGAGGCTGCAGG - Intergenic
954681140 3:52346618-52346640 GCTGGTGAAGTACATGCTGCAGG + Exonic
954692917 3:52405273-52405295 GATGGTGCAGAGGAGGCGGCTGG - Exonic
954745592 3:52785877-52785899 GCTGGTGCATAGGATGCCCTTGG + Intronic
954860222 3:53681916-53681938 GAAGGAGCAGAGGATGCTGGAGG + Intronic
954896607 3:53980250-53980272 GCTGGAGAAGAGGATGTTGAGGG + Intergenic
959991825 3:112639176-112639198 GCTGCTGAAGAAGACGCTGCAGG - Exonic
961201355 3:125048304-125048326 GGTGGTGCAGACCCTGCTGCAGG + Intronic
961349261 3:126288584-126288606 GCAGGCGCAGAGGACGCTGTTGG - Intergenic
962987956 3:140552855-140552877 GATGGTGCAGGGGATGAGGCTGG + Intronic
963969731 3:151416338-151416360 GCTGGGGCTGGGGAGGCTGCTGG - Exonic
966941451 3:184750492-184750514 GTTGGGGGAGAGGCTGCTGCCGG + Intergenic
968602203 4:1515236-1515258 GGTGGTGGAGATGATGGTGCTGG + Intergenic
969100235 4:4763161-4763183 CCTGGTGCAGGGGGTGGTGCAGG - Intergenic
969115834 4:4870236-4870258 GCTGGTGCAGAGGAAACTATGGG + Intergenic
970423882 4:15929109-15929131 ACTGGAGCAGAGGAGTCTGCCGG - Intergenic
971280529 4:25239444-25239466 GCAGCTGCAGAGGGTGCTGCTGG - Intronic
971281677 4:25246826-25246848 GCAGCTGCAGAGGGTGCTGCTGG - Intronic
972505779 4:39718714-39718736 GCAGCTGCGGAGGATGCGGCCGG - Intronic
972680842 4:41305576-41305598 GCAGGTGTAGTGGATGCTGTTGG + Intergenic
973605098 4:52579050-52579072 GCTGGTGCTGGTGGTGCTGCTGG + Intergenic
974839788 4:67286909-67286931 GCAGTTGCAGAGGGTGCTCCAGG - Intergenic
975562674 4:75722229-75722251 TCCTGTGCAGGGGATGCTGCTGG + Intronic
976074717 4:81284739-81284761 GCTGGAGCAGAGGGAGCTGGGGG - Intergenic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
977885163 4:102245190-102245212 GCAGGTGCAGAGGGTGCTCCAGG + Intergenic
981084573 4:140669769-140669791 GCTGGAGGAGACGAGGCTGCTGG + Exonic
983692092 4:170482649-170482671 GCTGGAGCGCTGGATGCTGCTGG - Intergenic
984857238 4:184205707-184205729 GCTGGAGTAGAGGAGGCTCCAGG + Intronic
985279467 4:188270928-188270950 GCTGGTGCTGGTGCTGCTGCTGG - Intergenic
985587737 5:749612-749634 GCTGTTCCAGATGATTCTGCAGG - Intronic
985602399 5:842079-842101 GCTGTTCCAGATGATTCTGCAGG - Intronic
985682583 5:1264345-1264367 GCTGGGGCAGGTGCTGCTGCAGG - Intronic
985886881 5:2686927-2686949 ACTGGTGCAGAGGCTGCCGCTGG + Intergenic
986017995 5:3774917-3774939 CCTGGTGGGGAGGATGCTGTAGG - Intergenic
986204857 5:5613930-5613952 TCAGGTGCTGGGGATGCTGCTGG + Intergenic
986336341 5:6758615-6758637 GCTGCTCCAGAGGCTGCTCCTGG - Intergenic
987035588 5:14015160-14015182 GCTGGTGGGGAAGATGCTGGAGG + Intergenic
987277507 5:16377198-16377220 GCTTGGGCAGAGAATGCTGGAGG - Intergenic
989780688 5:45262003-45262025 GCTGGTGGAGGGGGTGCTGGAGG + Exonic
990515594 5:56528334-56528356 TGTGGTGCAGCAGATGCTGCTGG + Intronic
991930548 5:71749430-71749452 GCGGATGCAGAGGAAGCAGCAGG - Intergenic
992773567 5:80070706-80070728 GCTTGTGACGAGGATGCTGACGG + Exonic
992887158 5:81170114-81170136 GGTGGTGCAGGTGATGCTGGTGG - Intronic
994177793 5:96730804-96730826 GCTGGTGGAGAGAGTGTTGCTGG + Exonic
996248941 5:121302993-121303015 ATTGGAGCAGAGGATGCTGGAGG - Intergenic
996409317 5:123139888-123139910 GGTGGTAAAAAGGATGCTGCAGG + Intronic
996790755 5:127290707-127290729 GCTGCTGCAGCTGCTGCTGCCGG - Intergenic
997411965 5:133697340-133697362 GCTGGTGGAGAGGCTGCATCTGG - Intergenic
997847506 5:137301234-137301256 GCTGGAGGAGAAGATCCTGCAGG - Intronic
997942008 5:138166547-138166569 GCCGGAGCAGAGGATGGTGCTGG + Exonic
997999267 5:138611061-138611083 GCTGGGCCAGAGAATGTTGCTGG - Intronic
999234222 5:150080858-150080880 GTTGGTGCTGAGGATGCTGCTGG + Exonic
999481002 5:151948196-151948218 GGTGCTGCAGAGGATGTTTCTGG + Intergenic
1001360339 5:171078037-171078059 GCTGGTGGAGAAGTTGCGGCAGG + Intronic
1001742759 5:174067691-174067713 GCAGGTGCAGAGGTGGATGCAGG + Intronic
1001742934 5:174068694-174068716 GCTGGTGCTGTGGAAGGTGCTGG + Intronic
1001742944 5:174068747-174068769 GCTGGTGCTGTGGAAGGTGCTGG + Intronic
1001742954 5:174068800-174068822 GCTGGTGCTGTGGAAGGTGCTGG + Intronic
1001742964 5:174068853-174068875 GCTGGTGCTGTGGAAGGTGCTGG + Intronic
1001742974 5:174068906-174068928 GCTGGTGCTGTGGAAGGTGCTGG + Intronic
1002043501 5:176530137-176530159 GCGGGGGCAGTGGCTGCTGCAGG + Exonic
1002051001 5:176571209-176571231 GCAGGTGCAGAGGGAGATGCTGG + Exonic
1002971765 6:2030115-2030137 GGTTGTGCAGAGCATGCTGTGGG - Intronic
1003065783 6:2902910-2902932 GCAGGTGGGGAGGAGGCTGCAGG + Intronic
1003086388 6:3064329-3064351 GCAGGTGGGGAGGAGGCTGCAGG - Intronic
1003165038 6:3670286-3670308 CCTGGTGAAGATGCTGCTGCTGG + Intergenic
1003705012 6:8516543-8516565 GCAGGGGCAGAGGTTGCTTCAGG - Intergenic
1003936250 6:10977806-10977828 GCTGGGGCAGGGGATGCTTCAGG - Intronic
1004311619 6:14551171-14551193 GCTGGAGAAGAGAATGCTACTGG - Intergenic
1004924094 6:20402516-20402538 CGTGGTGTAGAGGAGGCTGCCGG - Exonic
1005689933 6:28294339-28294361 GCTGATGCAGATGCTGCAGCAGG + Intronic
1005885011 6:30091066-30091088 GCTGGAGCAGAGGGAGCAGCGGG + Intergenic
1006044315 6:31281360-31281382 GCTGGTGCAGACAAAGCAGCGGG + Intronic
1006073814 6:31516399-31516421 GCTGGGGCAGAAGCTGCAGCAGG - Intergenic
1006421286 6:33935686-33935708 GCTGCAGCAGAGGCAGCTGCGGG + Intergenic
1007177639 6:39907739-39907761 GCTGGTGCTGCTGGTGCTGCTGG - Intronic
1007247837 6:40475160-40475182 GCTGGTGCCCAGGCTGCAGCTGG - Intronic
1007376238 6:41458607-41458629 CCTGGTGCATAAGATGCTGGTGG - Intergenic
1007585908 6:42989326-42989348 GCTGGTGCAGAGGTTGGGCCTGG - Intronic
1008555693 6:52671146-52671168 GCTGGTGCGGAGACTGCTTCCGG + Exonic
1009937724 6:70253392-70253414 CCTGGTGCAAAGGGTGTTGCTGG - Exonic
1012601729 6:101106581-101106603 GCTGAGGCAAAGGATGCTGGAGG + Intergenic
1013213142 6:108004494-108004516 GCTGGTGCAGATGAAACGGCAGG - Intergenic
1014224102 6:118828495-118828517 GCTGCTGCAGAGGCTGAGGCAGG - Intronic
1015569289 6:134604706-134604728 GGTGGTGCGGGGGGTGCTGCTGG - Intergenic
1017382275 6:153844669-153844691 GCTGGAGGAGAGGATGATGAGGG - Intergenic
1017899351 6:158705847-158705869 GCTGGTGCACAGCAGTCTGCGGG - Intronic
1017996339 6:159534595-159534617 GCTGGTGCAGAGGAGCTGGCAGG + Intergenic
1018259875 6:161959424-161959446 GCTGCTGCAGAGGCTGTGGCAGG - Intronic
1018472132 6:164106535-164106557 GCTGTGTCTGAGGATGCTGCAGG + Intergenic
1018747968 6:166777113-166777135 GCTGGACCTGAGGTTGCTGCGGG + Intronic
1019550152 7:1598146-1598168 GCTGGTGCAGAGGCCAGTGCGGG + Intergenic
1019570298 7:1708303-1708325 CCTGGTGCTGAGGATTCTCCAGG - Intronic
1019646886 7:2135609-2135631 GCTGGTGCAGAGGAAGGCTCAGG + Intronic
1021107194 7:16651557-16651579 GTCGGTGCAGAGGAAACTGCTGG + Intronic
1022417684 7:30191990-30192012 GCTGGTGCAGCTCATGCTGCTGG + Intergenic
1022517243 7:30983896-30983918 GCTGGTGGAGAAGGGGCTGCTGG + Intronic
1022905610 7:34852459-34852481 GCTGGAGCAGAGGATCTTGGTGG + Intronic
1023888645 7:44377533-44377555 ACTGGAGCAGAGGCTGCTGCTGG - Intergenic
1024022944 7:45387642-45387664 GCTGGTCCAGAGGGTGTTACAGG + Intergenic
1024242769 7:47448197-47448219 GTGAGTGCAGAGGAGGCTGCTGG - Intronic
1024292655 7:47816059-47816081 GCTGGTGCAGAGGGAGCGCCGGG + Intronic
1024741283 7:52357818-52357840 GATGGTGGAGAGGAGGCTGGAGG - Intergenic
1026005709 7:66598816-66598838 GCAGCAGCAGAGGATCCTGCAGG - Intergenic
1026242240 7:68586489-68586511 GCTGGTGCATAGGAGGCTTTAGG - Intergenic
1026366485 7:69653821-69653843 GCTGATGCAGAGGAGGTGGCAGG - Intronic
1026850429 7:73719894-73719916 GCTGGGGCAGAGGAGGCAGCAGG - Intergenic
1026853230 7:73737636-73737658 GCTGGGGCAGAAGGTCCTGCAGG + Exonic
1029126345 7:98297405-98297427 GCTGCAGCAGAGAATGCTGGTGG + Intronic
1029286373 7:99468690-99468712 GCTGGGGCAGGGGAAGCTGAGGG + Intergenic
1029474277 7:100773749-100773771 GCAGGTGCAGAGCCTGGTGCAGG - Exonic
1030175636 7:106650297-106650319 TCAGGTGCAGTGGATGCAGCAGG + Intergenic
1031965984 7:128028893-128028915 GCTGCTGCGGATGTTGCTGCTGG + Exonic
1031998152 7:128246342-128246364 GCTGGTGCAGAGGACCCAGGTGG + Intronic
1034398636 7:150846775-150846797 GCTGGGGCAGAGGTTGGGGCTGG + Intronic
1034496669 7:151427432-151427454 GCAGGGGCAGAGGATACGGCTGG - Intergenic
1035376995 7:158412515-158412537 CCTGGTGCTGAGGAGGGTGCTGG - Intronic
1035377131 7:158412987-158413009 CCTGGTGCTGAGGAGGGTGCTGG - Intronic
1037374991 8:18217828-18217850 GCTGTTGCAGGGGCTGGTGCAGG + Intronic
1038336804 8:26652177-26652199 GTTGGGGCAGTGGGTGCTGCCGG + Intronic
1039203702 8:35125157-35125179 GCTGGTGCAGAAGCCTCTGCTGG + Intergenic
1040940372 8:52826645-52826667 TCAGGTGCAGAGGAGGCTGGAGG - Intergenic
1041136849 8:54768115-54768137 GCTGACGCACAGGAGGCTGCTGG - Intergenic
1041792600 8:61714192-61714214 GCTGGCGCGGCGGACGCTGCGGG - Intronic
1041897957 8:62947862-62947884 GCTGGGGCACGGGAGGCTGCAGG - Intronic
1043142178 8:76603804-76603826 GCTGGTGCAGACGCAGCTTCTGG + Intergenic
1043284897 8:78516338-78516360 GCGGGAGCGGAGGCTGCTGCTGG + Exonic
1043395033 8:79827675-79827697 GCTGGTGGAGGGGAGGCTGTGGG - Intergenic
1044463771 8:92480046-92480068 CATGGTGCAGAGGCTGCTGTTGG + Intergenic
1045507115 8:102786717-102786739 GCTGTTGCAGATGAAGGTGCAGG - Intergenic
1045857618 8:106782213-106782235 GATGGTGTAGAGGATGATTCAGG + Intergenic
1046651996 8:116845629-116845651 GCTGGTACAGAGGAAGCTTTGGG - Intronic
1046700497 8:117395454-117395476 GCAGGTGAAGCTGATGCTGCTGG + Intergenic
1047807238 8:128373228-128373250 GCTGGTGGCGCTGATGCTGCTGG + Intergenic
1047807253 8:128373369-128373391 GCTGGTACAGATTATGGTGCTGG + Intergenic
1047807285 8:128373645-128373667 GCTGGTGGTGCTGATGCTGCTGG + Intergenic
1049018786 8:139939852-139939874 GCTGGTGCAGAGGCAGGTGCAGG + Intronic
1049399673 8:142419327-142419349 GCAGGTGCAGCAGATGCAGCAGG + Intergenic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049642256 8:143720993-143721015 GCTGGGGCAGTGGAACCTGCAGG - Exonic
1049671007 8:143869854-143869876 GCAGGTCCAGAGGAGCCTGCAGG - Exonic
1049774923 8:144399781-144399803 GCTGGTGGTGAGGACGCTGGCGG + Exonic
1049979432 9:890824-890846 GCTACTGCAGAGGATGAGGCAGG - Intronic
1050266295 9:3893696-3893718 GCTGGTCCAGGTGCTGCTGCTGG - Intronic
1050358591 9:4805699-4805721 GGTGGTGCAGTGCATGCTGGTGG + Intronic
1051606611 9:18923299-18923321 GCTGGAGCAGAGGATGGAGGTGG + Intergenic
1051637019 9:19190072-19190094 GCTGATGCAGAAGAAGCTCCTGG + Intergenic
1051798210 9:20900072-20900094 CCTGTTGCAGAGGAAGCTGAAGG + Intronic
1052146254 9:25052917-25052939 GTTGTTGCAGAGGATGTTGTCGG + Intergenic
1056942170 9:90965005-90965027 GCTGGTGCTGAGGATGCAACCGG - Intergenic
1058872802 9:109217009-109217031 GCTGGTGCTGATGCTGATGCTGG + Exonic
1059004425 9:110385455-110385477 GTTGCTGATGAGGATGCTGCTGG - Intronic
1059300866 9:113312220-113312242 GCTAGTGGAGAGGATGCAGAGGG + Intergenic
1059671796 9:116499047-116499069 GGTGGTGCAGAGGATTCTAAAGG - Intronic
1060283470 9:122228810-122228832 GTGGGAGCAGAGGCTGCTGCAGG + Exonic
1060827172 9:126693889-126693911 GCTGGGGCAGAGGCTGGGGCTGG + Intronic
1061137216 9:128741808-128741830 GCTGATTCAGAAGAAGCTGCTGG - Exonic
1061208525 9:129177668-129177690 GCTGGTGCAGCTGCTGCTGGAGG + Exonic
1061570579 9:131475416-131475438 ACTGCTGCAGTAGATGCTGCGGG - Exonic
1061814683 9:133187638-133187660 GCTGGTGCGGGAGCTGCTGCTGG + Intergenic
1062035699 9:134381625-134381647 TCTGGTACAGAGGGTGGTGCTGG + Intronic
1062044087 9:134417237-134417259 GCCGGTGGAGAGGATCCTGGAGG + Exonic
1062107661 9:134764487-134764509 GCTGGGGCAGAGTCTGCTGGAGG - Intronic
1062178880 9:135180009-135180031 GCCACAGCAGAGGATGCTGCTGG + Intergenic
1062594897 9:137295276-137295298 CCTGGGGCAGAGGAAGCGGCAGG - Intergenic
1202799637 9_KI270719v1_random:163502-163524 GCTGGAGCCGGGGGTGCTGCTGG + Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185977586 X:4738837-4738859 GCTGGAGCAAAGGAGGCTGTAGG + Intergenic
1186816000 X:13238693-13238715 GCTGATGCTGCTGATGCTGCTGG - Intergenic
1186873166 X:13792221-13792243 GCTGGGGGAGAGGGTGCTTCTGG + Intronic
1186996406 X:15128232-15128254 GCTGGTGATGCTGATGCTGCTGG - Intergenic
1187556615 X:20358046-20358068 CCTGGTGCAGTGGATGCTGCTGG + Intergenic
1188835457 X:34948713-34948735 GCTGCTGCAGCAGCTGCTGCTGG + Intergenic
1189232661 X:39464519-39464541 GGTGGGGCTGAGGGTGCTGCAGG + Intergenic
1189245240 X:39558239-39558261 GCTGGGGAACAGGTTGCTGCAGG + Intergenic
1190066779 X:47247114-47247136 GCTGGACCTGTGGATGCTGCCGG + Exonic
1198213754 X:134538008-134538030 GCAGGTGCAGAAGGTGCTGAGGG - Intergenic
1198312960 X:135438164-135438186 GGACGAGCAGAGGATGCTGCAGG + Intergenic
1198422825 X:136484872-136484894 CCAGGTGATGAGGATGCTGCTGG - Intergenic
1198493116 X:137163645-137163667 TCTGGTGCAGTGGCTGCTGCTGG + Intergenic
1199458314 X:148054252-148054274 GAGGGTGCTGAGGATGCTGAGGG + Intergenic
1201501322 Y:14645994-14646016 GTTGGTGATGAGGATGCTGAAGG + Intronic