ID: 901449484

View in Genome Browser
Species Human (GRCh38)
Location 1:9327161-9327183
Sequence GTGGAGGCCGTGGGCTTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901449484_901449497 23 Left 901449484 1:9327161-9327183 CCCTCTAAGCCCACGGCCTCCAC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 901449497 1:9327207-9327229 CCCTGAGTATGGGCAGAAATTGG 0: 1
1: 0
2: 2
3: 15
4: 194
901449484_901449493 13 Left 901449484 1:9327161-9327183 CCCTCTAAGCCCACGGCCTCCAC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 901449493 1:9327197-9327219 ACGATGATCCCCCTGAGTATGGG 0: 1
1: 0
2: 0
3: 3
4: 35
901449484_901449492 12 Left 901449484 1:9327161-9327183 CCCTCTAAGCCCACGGCCTCCAC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 901449492 1:9327196-9327218 TACGATGATCCCCCTGAGTATGG 0: 1
1: 0
2: 1
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901449484 Original CRISPR GTGGAGGCCGTGGGCTTAGA GGG (reversed) Intronic
901185154 1:7368158-7368180 GTGCAGGCCCTGGGCATGGATGG + Intronic
901449484 1:9327161-9327183 GTGGAGGCCGTGGGCTTAGAGGG - Intronic
902378636 1:16042228-16042250 GTGGAGGCAGTGGGTTTGGGAGG + Intergenic
904881292 1:33699010-33699032 CTTGAGGACGTGGGCTTTGAGGG - Intronic
907158818 1:52356952-52356974 GGGGAGGCTGTGGGCACAGAGGG + Intronic
910428847 1:87141483-87141505 GTGGAGGAGTTGGTCTTAGAAGG + Intronic
912858051 1:113189432-113189454 GTGGAGGCCTTAGACTTGGAAGG - Intergenic
914452074 1:147801397-147801419 CTCTAGGCCTTGGGCTTAGATGG - Intergenic
914827397 1:151145788-151145810 GTGGGGACCGTGGGCTCAGGAGG + Intronic
916771211 1:167910466-167910488 GTGGTGGACGTGGGCTAAGTGGG + Intronic
917084045 1:171287627-171287649 TTGGAGACAGTGGGCTTAAATGG - Intergenic
918093503 1:181316830-181316852 GAGGAGGCAGTGGGATTGGAAGG - Intergenic
919957981 1:202438414-202438436 GCGGGGGCAGAGGGCTTAGAGGG - Intronic
920180485 1:204129313-204129335 GAGGAGGCCGGGGGCCGAGAGGG - Intergenic
920501841 1:206490501-206490523 GTGGATGAAGTGGGCTTAGAAGG - Intronic
921876240 1:220199843-220199865 GTGGAGGCAGTGGAGTTGGAAGG - Intronic
922919555 1:229290519-229290541 GTGGAGCAGGTGGGCTTGGAGGG - Intronic
923469781 1:234280209-234280231 GGGGAAGCCATGGGCTGAGAAGG - Intronic
1071695372 10:87863885-87863907 GTGGAAGCCGTGGGCTCGGGCGG + Exonic
1075702648 10:124479162-124479184 GTGGGGGCCATGGTCTCAGAGGG + Intronic
1076668456 10:132105774-132105796 GTGCCTGCCGTGGGCTTGGAAGG + Intronic
1077227116 11:1443260-1443282 TTGGAGGGCCTGGGCTCAGAGGG - Intronic
1077387489 11:2277168-2277190 GTGGAGGCTTGGGGCTGAGAGGG + Intergenic
1077922302 11:6650638-6650660 GGTGAGTCCGTGGGCTAAGAGGG + Intronic
1082082123 11:48020371-48020393 GTGGAGGGCGTTGGCATAGGAGG + Intronic
1083309062 11:61775318-61775340 GTGGAGGGCGGGGGCTGCGATGG - Intronic
1088877350 11:113947025-113947047 GTGGAGGCAGTGGACTTAGCTGG - Intergenic
1089188472 11:116637033-116637055 GTGGAGGAGGAGGGCTTTGAAGG - Intergenic
1089865808 11:121630272-121630294 GAGGAAGCTGTGGGCTTACAGGG - Exonic
1091194157 11:133717770-133717792 GTGGTGGGAGTGGGCTAAGATGG - Intergenic
1091601558 12:1921131-1921153 GCGGTGGCCTTGGGCTGAGAAGG - Intergenic
1091657095 12:2353756-2353778 GTGCAGGCCCAGGGCTGAGATGG + Intronic
1092457941 12:8661233-8661255 GGGGAAGCCGTGGGGCTAGAAGG - Intronic
1093832188 12:23775873-23775895 TTGGAGACCGTGGCGTTAGATGG - Intronic
1097219497 12:57439424-57439446 GTAGAGGCCAAGGGCTGAGAGGG - Intronic
1102912885 12:116731898-116731920 GTGGAGGACATGTGCTGAGAGGG - Intronic
1106830792 13:33580372-33580394 GTGGTTGCCGTGGGCTTAGTGGG + Intergenic
1107383310 13:39879740-39879762 GTGGAAACAGTGGGCTAAGACGG - Intergenic
1112129260 13:96503517-96503539 TTGGAGGCAGTGGGCCTAGTAGG + Intronic
1113386748 13:109856022-109856044 GTGGGGGCCGGGGGCCTGGAGGG - Intergenic
1113905807 13:113818701-113818723 GGGGAGGCCCTGGCCTCAGAGGG - Intergenic
1114329598 14:21623131-21623153 GTGGGGGCTGTGGACTTAGAGGG + Intergenic
1121612247 14:95289621-95289643 TTGGAGGGCGTGGGCATTGAAGG + Intronic
1122593206 14:102870479-102870501 GGTGAGGCCGAGGGCTGAGAAGG - Intronic
1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG + Intronic
1125360613 15:38860673-38860695 GTGGAGACAATGGGCATAGAGGG - Intergenic
1129228773 15:74184891-74184913 GGGGAGGCCCTGGGCCTGGAGGG - Intronic
1129343633 15:74902677-74902699 GAAGAGGCCATGGGCTTAGGGGG + Exonic
1132106519 15:99066745-99066767 GTGGCGGTAGTGGGCTTGGAGGG + Intergenic
1132596705 16:754581-754603 GAGGAGGCAGTGAGCTGAGATGG + Intronic
1132933243 16:2469148-2469170 CGGGAGGCCGTGGGCCCAGAGGG - Intergenic
1132988261 16:2779252-2779274 GTGGAGGCCCCGGGCTTTGCCGG - Intergenic
1133314087 16:4871302-4871324 GTGAGGGCCGTGTGCTGAGATGG + Intronic
1133379108 16:5315158-5315180 GTGGAGTCTGTGGGCTGATAGGG + Intergenic
1134685385 16:16154841-16154863 GTGGAGGGGGTGGGCAAAGATGG - Intronic
1139662438 16:68430212-68430234 GTGGAGGGAGGGGGCATAGAGGG - Intronic
1141685229 16:85566267-85566289 GTGGAGGCAGTGGGCTGGGCAGG + Intergenic
1142173313 16:88634004-88634026 TTGGAGGCGGTGGCCCTAGAGGG + Intergenic
1143524481 17:7464044-7464066 GTGGAGGCACTGAGCTCAGACGG - Intronic
1143677222 17:8443184-8443206 GTGCAGGCATTGGGCTGAGACGG + Intronic
1144125590 17:12199646-12199668 GTGAAGGACGTGAGCTTGGAGGG + Intergenic
1146646009 17:34578173-34578195 TTGGAGGCCCTGGGGATAGAAGG - Intronic
1146674887 17:34766471-34766493 GTGGAGGACATGGGCTTGCAGGG - Intergenic
1148470265 17:47888907-47888929 GTGGAGGGTGTGGGTTCAGAAGG - Intergenic
1148796118 17:50197685-50197707 ATGGAGGCCATGGGGTCAGATGG + Intronic
1149698565 17:58636373-58636395 CTGGAGGCCCTGGGCTTATGAGG - Intronic
1150334855 17:64323274-64323296 GTGGAGGGCGAGGTCATAGAGGG + Exonic
1152841187 17:82569470-82569492 GTAGAGGTAGTGGGCTGAGAGGG + Intronic
1153080790 18:1222226-1222248 GTGGAGGCATTGGCCTTAGTGGG - Intergenic
1154231502 18:12559578-12559600 GTGGACGCCGTGGCCTGAGGAGG + Intronic
1154314891 18:13296878-13296900 GAGGAGGCCGTGAGCTTTGAGGG + Intronic
1155107575 18:22682899-22682921 GTGGAGGAGGTGGGATTTGAAGG - Intergenic
1157505332 18:48222205-48222227 GTGGAGGCTGGGAGCTTATAGGG - Intronic
1160722845 19:604871-604893 GTGGGGGCTGTGGGTTTGGAGGG + Intronic
1160880813 19:1319142-1319164 GCGGACGCGGAGGGCTTAGAGGG + Intergenic
1161930425 19:7336111-7336133 GAGGTGGCCGTGAGCTGAGATGG + Intergenic
1162417842 19:10548823-10548845 GTTGAGCCCCTGGGGTTAGAGGG + Intronic
1162932171 19:13962680-13962702 GGGGAGGCCAAGGGCTTAGCTGG + Exonic
1164194464 19:22943945-22943967 GTGAACGCAGTGGGCTTTGATGG + Intergenic
1164477052 19:28583789-28583811 GAGGTGGCAGTGGCCTTAGAAGG - Intergenic
1165340096 19:35205299-35205321 GAAGAGGCTGTGGGCGTAGAGGG + Intergenic
1165455776 19:35909658-35909680 GTGGTGACCGTGGGCTGAGCTGG - Intergenic
1165844543 19:38809797-38809819 GTGGAGGAGGTGGTCTAAGAAGG - Intronic
1165935898 19:39388874-39388896 ATGGAGGCACTGGGGTTAGATGG + Intronic
1166388690 19:42396879-42396901 GTGGGAGCCCTGGGCGTAGACGG - Intergenic
1166979630 19:46624930-46624952 GTAGAGGGTGTGGGGTTAGAGGG - Intronic
1167119400 19:47507672-47507694 GTGCAGGAGGTGGGCTTACAGGG - Intronic
1168477006 19:56683648-56683670 GTGAAGGAGGTGGGCTCAGAAGG - Intergenic
925461840 2:4069944-4069966 TTGAAGGCTGTGGGCTTGGAAGG - Intergenic
925488341 2:4362522-4362544 GTGGTTGCCGGGGGCTGAGAGGG - Intergenic
926385921 2:12335775-12335797 GTGAAGGGAGGGGGCTTAGACGG - Intergenic
926721762 2:15966249-15966271 GTGGAGGCGGTGGGTATGGAGGG + Intergenic
927708241 2:25310294-25310316 GGGGAGGCTGAGAGCTTAGAGGG - Intronic
927959802 2:27234017-27234039 GTGGATGCCGTGGCCTCTGATGG + Exonic
935447760 2:103174811-103174833 GGGGAGGTCATAGGCTTAGAAGG - Intergenic
937290074 2:120776734-120776756 GTGGAGGCCTGGGGCTGAGCCGG + Intronic
948747511 2:240107171-240107193 CAGGAGGACGTGGGCTAAGAGGG + Intergenic
1169093921 20:2879212-2879234 GTGAAGGCCCTGAGCTGAGAAGG + Intronic
1169198774 20:3697513-3697535 GTGGGGGCCCTGGGCAGAGAGGG + Intronic
1169251420 20:4064101-4064123 TAGGAGGCCGTGGGAATAGAAGG + Intergenic
1170835380 20:19879482-19879504 ATGGAATCCGTGGGCTTACAAGG + Intergenic
1172636228 20:36411754-36411776 GTGGTGGGCATGGGCTTTGAGGG - Intronic
1174854305 20:54028540-54028562 CTGGAGTCCTTGGGCTTGGAGGG + Exonic
1181481697 22:23203992-23204014 GTGCAGGCAGTGGGTTCAGATGG + Intronic
1182395520 22:30033284-30033306 GTGGAGGCCTTGCGTTCAGATGG + Intergenic
1182780237 22:32861697-32861719 GAGGAGGCCCTGGGCAAAGAAGG + Exonic
1183255704 22:36760495-36760517 GTGGAGTAGGTCGGCTTAGAGGG + Intronic
1183436029 22:37795781-37795803 GTGGTGGCCGTGGGGGTGGAAGG - Intergenic
1183437201 22:37802970-37802992 GCGGAGGCCCGGGACTTAGAAGG - Intergenic
1183599987 22:38834393-38834415 GTGGAGGCCTTAGGGTGAGAAGG - Intronic
1184096803 22:42320506-42320528 GTGCAGGCCGGGGGCTGGGACGG - Intronic
1184172788 22:42769454-42769476 GTGGAGACCGTGGGCTTGGGAGG + Intergenic
949258954 3:2083690-2083712 GTGGTGGGCGTGGGCTTGGCGGG + Intergenic
950591146 3:13936286-13936308 GTGAAGGCCCTGGGCTTTGCTGG - Intergenic
953373328 3:42408061-42408083 GAGGAGGTGGTGGGTTTAGATGG - Intronic
954430799 3:50470026-50470048 GTGGAGGCCATGGGCACAGAGGG - Intronic
954662455 3:52233293-52233315 GAGGAGGCCGAGGCCTCAGAGGG - Intronic
954801431 3:53189247-53189269 GTGGAGGCCCTGGGCTGGGCTGG + Intronic
959913623 3:111793048-111793070 GTAGAGCCCTTGGGCTTTGAGGG - Intronic
961003431 3:123389130-123389152 GTGCAGGACGTCGGCTGAGATGG + Intronic
964496413 3:157295365-157295387 GTGGAGGCAGTGAGCTATGATGG + Intronic
965744286 3:171907541-171907563 GTGGAGGCCGTGGCATGAGGAGG + Intronic
966185447 3:177222909-177222931 GTGGAGGTTGTGAGCTGAGATGG - Intergenic
966914516 3:184577488-184577510 GAGGAGGCCTTGGGCTGAGCTGG + Intronic
968276816 3:197446540-197446562 GAAGAGGCCGGGGGCTCAGAGGG + Intergenic
968649600 4:1755246-1755268 ATGGGGGCCGTGGACTTGGAGGG - Intergenic
969922376 4:10552519-10552541 GTGGAGGCATTGGGTTTAGGTGG - Intronic
974299319 4:60042709-60042731 GTGGATGCCGTGGCCTGAGGAGG + Intergenic
976765883 4:88596789-88596811 GTGGAGGCAGTAGGAATAGAGGG - Intronic
980740114 4:136939272-136939294 GTGGAGGCTGTGGGGTAGGATGG + Intergenic
983338131 4:166421744-166421766 TTGGAGCCAGTGGGCTTAGGGGG - Intergenic
985558451 5:569544-569566 CTGGACGGCGTGGGCTTAGGTGG + Intergenic
985783732 5:1883708-1883730 GTGGGGGCGGTGGGCTGAGCGGG - Intronic
986895029 5:12355053-12355075 GTGGAGACCCTGGGGTAAGAAGG - Intergenic
987911744 5:24155459-24155481 GTGGTGGCCGTGGCCATGGAGGG + Intronic
997671679 5:135679708-135679730 GTGGTGGCTGTGGGCTCGGAAGG + Intergenic
1000207936 5:159080057-159080079 GTTGAAGCTATGGGCTTAGATGG - Intronic
1001103111 5:168830242-168830264 ATGGAGGCCCTGGGCTGAGCGGG - Intronic
1001277304 5:170360109-170360131 AAGGAGGCCCTGGACTTAGAAGG - Intronic
1001929320 5:175661532-175661554 GTGTAGGCCGTGGATTTAGATGG - Intronic
1002641240 5:180631601-180631623 GTGGTGGCTGTGGGCCCAGATGG - Intronic
1003117933 6:3295612-3295634 GTGTTGGCTGTGGGATTAGATGG + Intronic
1003952443 6:11128549-11128571 TTGGAGCCAGTGGACTTAGAGGG - Intronic
1006563886 6:34937532-34937554 GTGGAGGCTGCGGCCTTTGAAGG + Intronic
1006829213 6:36958642-36958664 GGGGAGGGTGGGGGCTTAGAGGG + Intronic
1007940267 6:45774129-45774151 CTGGAGGAAGTGGGCTTAAATGG + Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1017122955 6:151041172-151041194 CTGGAGGCGGTGGCCCTAGAGGG + Intronic
1017607043 6:156145775-156145797 GTGGTGGCTGTGGGATGAGAAGG - Intergenic
1017995137 6:159525669-159525691 GTAGAGCCCGTGTGCGTAGATGG - Intergenic
1018263138 6:161990081-161990103 GTGGTGGCAGTGGGCTGGGAGGG - Intronic
1019221941 6:170479899-170479921 GTGAAGGCCCTGGGCTCGGATGG + Intergenic
1019274167 7:167149-167171 CGGGAAGGCGTGGGCTTAGAAGG + Intergenic
1020627179 7:10596148-10596170 ATGGAGGCCGTGGGGAGAGAAGG - Intergenic
1022715269 7:32892305-32892327 GCCGAGGCCTTGGGCCTAGACGG + Intronic
1023048639 7:36232714-36232736 GTGGAGGCTGGGGGGTTGGAGGG + Intronic
1024178732 7:46866893-46866915 GTGGTTGCCATGGGATTAGAGGG - Intergenic
1027695781 7:81408501-81408523 GTGGAGGTGGTGAACTTAGAAGG + Intergenic
1031656941 7:124367814-124367836 ATGGATGCCCTGGACTTAGATGG + Intergenic
1035392000 7:158510318-158510340 GTGGGTGCCGTGGGCTGAGTTGG - Intronic
1035571768 8:677065-677087 GGGCAGGCCCTGGGCTTTGAGGG - Intronic
1037593157 8:20330411-20330433 GTGGAGGCAGTGAGCAGAGATGG - Intergenic
1037777157 8:21843058-21843080 GGAGAGGGGGTGGGCTTAGAAGG - Intergenic
1037802847 8:22044538-22044560 GAGGAGGCCGTCGGCCAAGAGGG + Intronic
1039474698 8:37833505-37833527 GTGGTGGCCTTGGGCTGTGATGG + Intronic
1039695588 8:39906960-39906982 GTGGAGGCTGAGGGCTGAGATGG + Intronic
1041344187 8:56878857-56878879 GGGGAGCCCCTGAGCTTAGAAGG + Intergenic
1043019394 8:74982465-74982487 TTGGAGGCTATGGGCTTGGAAGG + Intergenic
1044229401 8:89757594-89757616 GCGGAGGCCGAGGGCTGGGACGG - Intergenic
1044467767 8:92526505-92526527 GTGGTGGCAGCGGGCTGAGAAGG - Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048846055 8:138604648-138604670 GCTCAGGCCCTGGGCTTAGAAGG - Intronic
1049624387 8:143613534-143613556 GTGGAGGCCATGGACTTCCATGG - Exonic
1049912869 9:286479-286501 GTGGAGCCAGTGGACTTTGAAGG + Exonic
1050536637 9:6636408-6636430 GTGGAGGCAGTGGGTTTAATGGG + Intronic
1050744215 9:8857987-8858009 GCGGAAGCCGCGGGCTCAGAAGG - Intronic
1052888902 9:33677223-33677245 GTGGAAGCCGTGGGCTTGGGCGG - Intergenic
1053684337 9:40507306-40507328 CTGGAGGCAGTGGCCCTAGAGGG + Intergenic
1053934306 9:43135592-43135614 CTGGAGGCGGTGGCCCTAGAGGG + Intergenic
1054279388 9:63117647-63117669 CTGGAGGCAGTGGCCCTAGAGGG - Intergenic
1054297431 9:63342770-63342792 CTGGAGGCAGTGGCCCTAGAGGG + Intergenic
1054395449 9:64647278-64647300 CTGGAGGCAGTGGCCCTAGAGGG + Intergenic
1054430096 9:65152478-65152500 CTGGAGGCAGTGGACCTAGAGGG + Intergenic
1054500288 9:65869054-65869076 CTGGAGGCAGTGGCCCTAGAGGG - Intergenic
1054787843 9:69226185-69226207 GAGGAGGCTGTGAGCTTAGCTGG + Intronic
1057517142 9:95731445-95731467 GTGGAAGTCATAGGCTTAGAAGG - Intergenic
1060834412 9:126744340-126744362 GTAGAGGCTGTGTGCATAGAAGG + Intergenic
1061709479 9:132477791-132477813 TGGGAGGCCGTAGGCTCAGACGG + Intronic
1061801088 9:133113756-133113778 GTGAAGGCCGTTGGCTCAGCTGG + Intronic
1062126348 9:134864998-134865020 GAGGAGGCAGTGGGCGTACAGGG + Intergenic
1062428744 9:136517622-136517644 GTGCAGGCTGTGGGCCCAGAAGG + Intronic
1186888398 X:13937854-13937876 GTGGAGGCGGTGTGCTGAGCGGG - Intronic
1191110964 X:56802977-56802999 GTGGAGGCCGTCGGATTGGAGGG + Intergenic
1192358632 X:70425010-70425032 GTGGAGGCAGCGGGCCCAGACGG - Exonic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1195388239 X:104333926-104333948 GTGGAAGGAGTGGTCTTAGATGG + Intergenic
1196803712 X:119566025-119566047 GTGGTTGCCGTGGGCTGGGAAGG - Intergenic
1197859071 X:130950188-130950210 GTAGAAGAAGTGGGCTTAGATGG - Intergenic
1200018286 X:153181512-153181534 GGGGAGGCCTTGGTCTGAGAAGG + Intronic